ID: 1103147540

View in Genome Browser
Species Human (GRCh38)
Location 12:118608779-118608801
Sequence GGAGGAAGGGAAATTTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103147540_1103147545 -5 Left 1103147540 12:118608779-118608801 CCAGACCAAATTTCCCTTCCTCC No data
Right 1103147545 12:118608797-118608819 CCTCCAGCTCTAGTGACTAGAGG No data
1103147540_1103147551 21 Left 1103147540 12:118608779-118608801 CCAGACCAAATTTCCCTTCCTCC No data
Right 1103147551 12:118608823-118608845 GGTAGGGAGAGAGCTGGAAGAGG No data
1103147540_1103147548 4 Left 1103147540 12:118608779-118608801 CCAGACCAAATTTCCCTTCCTCC No data
Right 1103147548 12:118608806-118608828 CTAGTGACTAGAGGCAAGGTAGG No data
1103147540_1103147554 30 Left 1103147540 12:118608779-118608801 CCAGACCAAATTTCCCTTCCTCC No data
Right 1103147554 12:118608832-118608854 AGAGCTGGAAGAGGAAAGGAGGG No data
1103147540_1103147552 26 Left 1103147540 12:118608779-118608801 CCAGACCAAATTTCCCTTCCTCC No data
Right 1103147552 12:118608828-118608850 GGAGAGAGCTGGAAGAGGAAAGG No data
1103147540_1103147550 15 Left 1103147540 12:118608779-118608801 CCAGACCAAATTTCCCTTCCTCC No data
Right 1103147550 12:118608817-118608839 AGGCAAGGTAGGGAGAGAGCTGG No data
1103147540_1103147547 0 Left 1103147540 12:118608779-118608801 CCAGACCAAATTTCCCTTCCTCC No data
Right 1103147547 12:118608802-118608824 AGCTCTAGTGACTAGAGGCAAGG No data
1103147540_1103147553 29 Left 1103147540 12:118608779-118608801 CCAGACCAAATTTCCCTTCCTCC No data
Right 1103147553 12:118608831-118608853 GAGAGCTGGAAGAGGAAAGGAGG No data
1103147540_1103147549 5 Left 1103147540 12:118608779-118608801 CCAGACCAAATTTCCCTTCCTCC No data
Right 1103147549 12:118608807-118608829 TAGTGACTAGAGGCAAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103147540 Original CRISPR GGAGGAAGGGAAATTTGGTC TGG (reversed) Intergenic
No off target data available for this crispr