ID: 1103147546

View in Genome Browser
Species Human (GRCh38)
Location 12:118608800-118608822
Sequence TTGCCTCTAGTCACTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103147546_1103147551 0 Left 1103147546 12:118608800-118608822 CCAGCTCTAGTGACTAGAGGCAA No data
Right 1103147551 12:118608823-118608845 GGTAGGGAGAGAGCTGGAAGAGG No data
1103147546_1103147555 10 Left 1103147546 12:118608800-118608822 CCAGCTCTAGTGACTAGAGGCAA No data
Right 1103147555 12:118608833-118608855 GAGCTGGAAGAGGAAAGGAGGGG No data
1103147546_1103147553 8 Left 1103147546 12:118608800-118608822 CCAGCTCTAGTGACTAGAGGCAA No data
Right 1103147553 12:118608831-118608853 GAGAGCTGGAAGAGGAAAGGAGG No data
1103147546_1103147557 18 Left 1103147546 12:118608800-118608822 CCAGCTCTAGTGACTAGAGGCAA No data
Right 1103147557 12:118608841-118608863 AGAGGAAAGGAGGGGAGAGAGGG No data
1103147546_1103147550 -6 Left 1103147546 12:118608800-118608822 CCAGCTCTAGTGACTAGAGGCAA No data
Right 1103147550 12:118608817-118608839 AGGCAAGGTAGGGAGAGAGCTGG No data
1103147546_1103147552 5 Left 1103147546 12:118608800-118608822 CCAGCTCTAGTGACTAGAGGCAA No data
Right 1103147552 12:118608828-118608850 GGAGAGAGCTGGAAGAGGAAAGG No data
1103147546_1103147554 9 Left 1103147546 12:118608800-118608822 CCAGCTCTAGTGACTAGAGGCAA No data
Right 1103147554 12:118608832-118608854 AGAGCTGGAAGAGGAAAGGAGGG No data
1103147546_1103147556 17 Left 1103147546 12:118608800-118608822 CCAGCTCTAGTGACTAGAGGCAA No data
Right 1103147556 12:118608840-118608862 AAGAGGAAAGGAGGGGAGAGAGG No data
1103147546_1103147558 29 Left 1103147546 12:118608800-118608822 CCAGCTCTAGTGACTAGAGGCAA No data
Right 1103147558 12:118608852-118608874 GGGGAGAGAGGGAAAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103147546 Original CRISPR TTGCCTCTAGTCACTAGAGC TGG (reversed) Intergenic
No off target data available for this crispr