ID: 1103147555

View in Genome Browser
Species Human (GRCh38)
Location 12:118608833-118608855
Sequence GAGCTGGAAGAGGAAAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103147543_1103147555 17 Left 1103147543 12:118608793-118608815 CCTTCCTCCAGCTCTAGTGACTA No data
Right 1103147555 12:118608833-118608855 GAGCTGGAAGAGGAAAGGAGGGG No data
1103147542_1103147555 18 Left 1103147542 12:118608792-118608814 CCCTTCCTCCAGCTCTAGTGACT No data
Right 1103147555 12:118608833-118608855 GAGCTGGAAGAGGAAAGGAGGGG No data
1103147544_1103147555 13 Left 1103147544 12:118608797-118608819 CCTCCAGCTCTAGTGACTAGAGG No data
Right 1103147555 12:118608833-118608855 GAGCTGGAAGAGGAAAGGAGGGG No data
1103147546_1103147555 10 Left 1103147546 12:118608800-118608822 CCAGCTCTAGTGACTAGAGGCAA No data
Right 1103147555 12:118608833-118608855 GAGCTGGAAGAGGAAAGGAGGGG No data
1103147541_1103147555 26 Left 1103147541 12:118608784-118608806 CCAAATTTCCCTTCCTCCAGCTC No data
Right 1103147555 12:118608833-118608855 GAGCTGGAAGAGGAAAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103147555 Original CRISPR GAGCTGGAAGAGGAAAGGAG GGG Intergenic
No off target data available for this crispr