ID: 1103147558

View in Genome Browser
Species Human (GRCh38)
Location 12:118608852-118608874
Sequence GGGGAGAGAGGGAAAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103147546_1103147558 29 Left 1103147546 12:118608800-118608822 CCAGCTCTAGTGACTAGAGGCAA No data
Right 1103147558 12:118608852-118608874 GGGGAGAGAGGGAAAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103147558 Original CRISPR GGGGAGAGAGGGAAAGAGAG AGG Intergenic
No off target data available for this crispr