ID: 1103149981

View in Genome Browser
Species Human (GRCh38)
Location 12:118628972-118628994
Sequence TTGAGGGGATGGAGGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103149974_1103149981 -1 Left 1103149974 12:118628950-118628972 CCGTCAAGGCAGATGCTATCTTT No data
Right 1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103149981 Original CRISPR TTGAGGGGATGGAGGGAACA TGG Intergenic
No off target data available for this crispr