ID: 1103150226

View in Genome Browser
Species Human (GRCh38)
Location 12:118631702-118631724
Sequence ATTCAGAAGGCCTTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103150226_1103150233 7 Left 1103150226 12:118631702-118631724 CCCTCCTCAAAGGCCTTCTGAAT No data
Right 1103150233 12:118631732-118631754 ACTAAAGGCAAACACCACCATGG No data
1103150226_1103150232 -8 Left 1103150226 12:118631702-118631724 CCCTCCTCAAAGGCCTTCTGAAT No data
Right 1103150232 12:118631717-118631739 TTCTGAATAGCTGGGACTAAAGG No data
1103150226_1103150234 11 Left 1103150226 12:118631702-118631724 CCCTCCTCAAAGGCCTTCTGAAT No data
Right 1103150234 12:118631736-118631758 AAGGCAAACACCACCATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103150226 Original CRISPR ATTCAGAAGGCCTTTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr