ID: 1103152831

View in Genome Browser
Species Human (GRCh38)
Location 12:118656209-118656231
Sequence GTTTCAGTGGGGAGATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103152821_1103152831 24 Left 1103152821 12:118656162-118656184 CCATTTGAGTGGCTATCATGAGG No data
Right 1103152831 12:118656209-118656231 GTTTCAGTGGGGAGATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103152831 Original CRISPR GTTTCAGTGGGGAGATGGGG AGG Intergenic
No off target data available for this crispr