ID: 1103159445

View in Genome Browser
Species Human (GRCh38)
Location 12:118716181-118716203
Sequence TCTTCCAACTGTGTGTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103159445_1103159456 29 Left 1103159445 12:118716181-118716203 CCTCACAACACACAGTTGGAAGA No data
Right 1103159456 12:118716233-118716255 GGAAGTGGCTTGAGGAGAGCTGG No data
1103159445_1103159450 2 Left 1103159445 12:118716181-118716203 CCTCACAACACACAGTTGGAAGA No data
Right 1103159450 12:118716206-118716228 GGTGGCCAGTAGACTGCTTTGGG No data
1103159445_1103159453 8 Left 1103159445 12:118716181-118716203 CCTCACAACACACAGTTGGAAGA No data
Right 1103159453 12:118716212-118716234 CAGTAGACTGCTTTGGGCAAGGG No data
1103159445_1103159452 7 Left 1103159445 12:118716181-118716203 CCTCACAACACACAGTTGGAAGA No data
Right 1103159452 12:118716211-118716233 CCAGTAGACTGCTTTGGGCAAGG No data
1103159445_1103159449 1 Left 1103159445 12:118716181-118716203 CCTCACAACACACAGTTGGAAGA No data
Right 1103159449 12:118716205-118716227 GGGTGGCCAGTAGACTGCTTTGG No data
1103159445_1103159455 21 Left 1103159445 12:118716181-118716203 CCTCACAACACACAGTTGGAAGA No data
Right 1103159455 12:118716225-118716247 TGGGCAAGGGAAGTGGCTTGAGG No data
1103159445_1103159454 14 Left 1103159445 12:118716181-118716203 CCTCACAACACACAGTTGGAAGA No data
Right 1103159454 12:118716218-118716240 ACTGCTTTGGGCAAGGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103159445 Original CRISPR TCTTCCAACTGTGTGTTGTG AGG (reversed) Intergenic
No off target data available for this crispr