ID: 1103159779

View in Genome Browser
Species Human (GRCh38)
Location 12:118719457-118719479
Sequence AAAACTGAGACTCAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103159774_1103159779 8 Left 1103159774 12:118719426-118719448 CCTAGGAAGGCGGCCTGGATGAG No data
Right 1103159779 12:118719457-118719479 AAAACTGAGACTCAGGAGACAGG No data
1103159776_1103159779 -5 Left 1103159776 12:118719439-118719461 CCTGGATGAGGTGAGCCTAAAAC No data
Right 1103159779 12:118719457-118719479 AAAACTGAGACTCAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103159779 Original CRISPR AAAACTGAGACTCAGGAGAC AGG Intergenic
No off target data available for this crispr