ID: 1103160953

View in Genome Browser
Species Human (GRCh38)
Location 12:118728863-118728885
Sequence GTACAAACCAAGGCTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103160953_1103160955 -10 Left 1103160953 12:118728863-118728885 CCTCTTTGAGCCTTGGTTTGTAC No data
Right 1103160955 12:118728876-118728898 TGGTTTGTACATTTATAAAATGG No data
1103160953_1103160957 8 Left 1103160953 12:118728863-118728885 CCTCTTTGAGCCTTGGTTTGTAC No data
Right 1103160957 12:118728894-118728916 AATGGATTAGTGTGAGGATTAGG No data
1103160953_1103160956 2 Left 1103160953 12:118728863-118728885 CCTCTTTGAGCCTTGGTTTGTAC No data
Right 1103160956 12:118728888-118728910 TTATAAAATGGATTAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103160953 Original CRISPR GTACAAACCAAGGCTCAAAG AGG (reversed) Intergenic
No off target data available for this crispr