ID: 1103162069

View in Genome Browser
Species Human (GRCh38)
Location 12:118737526-118737548
Sequence CCTGGTAAGGACCCTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103162069_1103162073 0 Left 1103162069 12:118737526-118737548 CCTGCAACAGGGTCCTTACCAGG No data
Right 1103162073 12:118737549-118737571 AACTGAATCTGCCCTCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103162069 Original CRISPR CCTGGTAAGGACCCTGTTGC AGG (reversed) Intergenic
No off target data available for this crispr