ID: 1103163840

View in Genome Browser
Species Human (GRCh38)
Location 12:118753357-118753379
Sequence AAAAAGTAATCCCAGAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103163840_1103163844 -3 Left 1103163840 12:118753357-118753379 CCCTATTTCTGGGATTACTTTTT No data
Right 1103163844 12:118753377-118753399 TTTTGGGACCTGTGTTGAGAAGG No data
1103163840_1103163847 23 Left 1103163840 12:118753357-118753379 CCCTATTTCTGGGATTACTTTTT No data
Right 1103163847 12:118753403-118753425 TAGTTACTTAGTGAAGGTTTTGG No data
1103163840_1103163848 24 Left 1103163840 12:118753357-118753379 CCCTATTTCTGGGATTACTTTTT No data
Right 1103163848 12:118753404-118753426 AGTTACTTAGTGAAGGTTTTGGG No data
1103163840_1103163846 17 Left 1103163840 12:118753357-118753379 CCCTATTTCTGGGATTACTTTTT No data
Right 1103163846 12:118753397-118753419 AGGTCTTAGTTACTTAGTGAAGG No data
1103163840_1103163849 29 Left 1103163840 12:118753357-118753379 CCCTATTTCTGGGATTACTTTTT No data
Right 1103163849 12:118753409-118753431 CTTAGTGAAGGTTTTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103163840 Original CRISPR AAAAAGTAATCCCAGAAATA GGG (reversed) Intergenic