ID: 1103163845

View in Genome Browser
Species Human (GRCh38)
Location 12:118753385-118753407
Sequence AACTAAGACCTTCTCAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103163845_1103163847 -5 Left 1103163845 12:118753385-118753407 CCTGTGTTGAGAAGGTCTTAGTT No data
Right 1103163847 12:118753403-118753425 TAGTTACTTAGTGAAGGTTTTGG No data
1103163845_1103163849 1 Left 1103163845 12:118753385-118753407 CCTGTGTTGAGAAGGTCTTAGTT No data
Right 1103163849 12:118753409-118753431 CTTAGTGAAGGTTTTGGGAATGG No data
1103163845_1103163850 18 Left 1103163845 12:118753385-118753407 CCTGTGTTGAGAAGGTCTTAGTT No data
Right 1103163850 12:118753426-118753448 GAATGGTCAAACTGATTTACTGG No data
1103163845_1103163848 -4 Left 1103163845 12:118753385-118753407 CCTGTGTTGAGAAGGTCTTAGTT No data
Right 1103163848 12:118753404-118753426 AGTTACTTAGTGAAGGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103163845 Original CRISPR AACTAAGACCTTCTCAACAC AGG (reversed) Intergenic