ID: 1103163849

View in Genome Browser
Species Human (GRCh38)
Location 12:118753409-118753431
Sequence CTTAGTGAAGGTTTTGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103163845_1103163849 1 Left 1103163845 12:118753385-118753407 CCTGTGTTGAGAAGGTCTTAGTT No data
Right 1103163849 12:118753409-118753431 CTTAGTGAAGGTTTTGGGAATGG No data
1103163841_1103163849 28 Left 1103163841 12:118753358-118753380 CCTATTTCTGGGATTACTTTTTT No data
Right 1103163849 12:118753409-118753431 CTTAGTGAAGGTTTTGGGAATGG No data
1103163840_1103163849 29 Left 1103163840 12:118753357-118753379 CCCTATTTCTGGGATTACTTTTT No data
Right 1103163849 12:118753409-118753431 CTTAGTGAAGGTTTTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103163849 Original CRISPR CTTAGTGAAGGTTTTGGGAA TGG Intergenic