ID: 1103164247

View in Genome Browser
Species Human (GRCh38)
Location 12:118756673-118756695
Sequence AGTTAATTGGAGAAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103164247_1103164254 -6 Left 1103164247 12:118756673-118756695 CCATCCATCTTCTCCAATTAACT No data
Right 1103164254 12:118756690-118756712 TTAACTTGGGGGAGAATATGAGG No data
1103164247_1103164256 4 Left 1103164247 12:118756673-118756695 CCATCCATCTTCTCCAATTAACT No data
Right 1103164256 12:118756700-118756722 GGAGAATATGAGGATGATGGTGG No data
1103164247_1103164255 1 Left 1103164247 12:118756673-118756695 CCATCCATCTTCTCCAATTAACT No data
Right 1103164255 12:118756697-118756719 GGGGGAGAATATGAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103164247 Original CRISPR AGTTAATTGGAGAAGATGGA TGG (reversed) Intergenic
No off target data available for this crispr