ID: 1103167026

View in Genome Browser
Species Human (GRCh38)
Location 12:118778946-118778968
Sequence CGGCCTTGGAGGTGACCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103167026_1103167031 -9 Left 1103167026 12:118778946-118778968 CCTCTGGGTCACCTCCAAGGCCG No data
Right 1103167031 12:118778960-118778982 CCAAGGCCGGCCTCCCATGGAGG No data
1103167026_1103167032 -6 Left 1103167026 12:118778946-118778968 CCTCTGGGTCACCTCCAAGGCCG No data
Right 1103167032 12:118778963-118778985 AGGCCGGCCTCCCATGGAGGTGG No data
1103167026_1103167035 3 Left 1103167026 12:118778946-118778968 CCTCTGGGTCACCTCCAAGGCCG No data
Right 1103167035 12:118778972-118778994 TCCCATGGAGGTGGTGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103167026 Original CRISPR CGGCCTTGGAGGTGACCCAG AGG (reversed) Intergenic
No off target data available for this crispr