ID: 1103168221

View in Genome Browser
Species Human (GRCh38)
Location 12:118789290-118789312
Sequence CAGGAAACAGCAGTGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103168221_1103168226 20 Left 1103168221 12:118789290-118789312 CCATCACCCACTGCTGTTTCCTG No data
Right 1103168226 12:118789333-118789355 TGATCTTACATCCTTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103168221 Original CRISPR CAGGAAACAGCAGTGGGTGA TGG (reversed) Intergenic
No off target data available for this crispr