ID: 1103172752

View in Genome Browser
Species Human (GRCh38)
Location 12:118835661-118835683
Sequence GGAAACACACAGAAGGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103172745_1103172752 24 Left 1103172745 12:118835614-118835636 CCAAAACAATGTGTAAGTGTGAC No data
Right 1103172752 12:118835661-118835683 GGAAACACACAGAAGGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103172752 Original CRISPR GGAAACACACAGAAGGGACA CGG Intergenic
No off target data available for this crispr