ID: 1103174106

View in Genome Browser
Species Human (GRCh38)
Location 12:118846946-118846968
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103174103_1103174106 -7 Left 1103174103 12:118846930-118846952 CCACACAGCCAGTGGGTGATGAC No data
Right 1103174106 12:118846946-118846968 TGATGACAGGAGAGTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103174106 Original CRISPR TGATGACAGGAGAGTGATCT TGG Intergenic
No off target data available for this crispr