ID: 1103174524

View in Genome Browser
Species Human (GRCh38)
Location 12:118850990-118851012
Sequence CTCTGCAAGGCTGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103174524_1103174529 -8 Left 1103174524 12:118850990-118851012 CCTTCCACCTCAGCCTTGCAGAG No data
Right 1103174529 12:118851005-118851027 TTGCAGAGTGCTGGTATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103174524 Original CRISPR CTCTGCAAGGCTGAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr