ID: 1103175867

View in Genome Browser
Species Human (GRCh38)
Location 12:118862605-118862627
Sequence CCCTTGGCCACTCTCCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103175867_1103175875 10 Left 1103175867 12:118862605-118862627 CCCTCTGGGAGAGTGGCCAAGGG No data
Right 1103175875 12:118862638-118862660 AGGCTGAAGAGCACAACTCCTGG No data
1103175867_1103175876 27 Left 1103175867 12:118862605-118862627 CCCTCTGGGAGAGTGGCCAAGGG No data
Right 1103175876 12:118862655-118862677 TCCTGGCTAATTTTCCTCCCAGG No data
1103175867_1103175873 -10 Left 1103175867 12:118862605-118862627 CCCTCTGGGAGAGTGGCCAAGGG No data
Right 1103175873 12:118862618-118862640 TGGCCAAGGGCGTGGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103175867 Original CRISPR CCCTTGGCCACTCTCCCAGA GGG (reversed) Intergenic
No off target data available for this crispr