ID: 1103175869

View in Genome Browser
Species Human (GRCh38)
Location 12:118862606-118862628
Sequence GCCCTTGGCCACTCTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103175869_1103175876 26 Left 1103175869 12:118862606-118862628 CCTCTGGGAGAGTGGCCAAGGGC No data
Right 1103175876 12:118862655-118862677 TCCTGGCTAATTTTCCTCCCAGG No data
1103175869_1103175875 9 Left 1103175869 12:118862606-118862628 CCTCTGGGAGAGTGGCCAAGGGC No data
Right 1103175875 12:118862638-118862660 AGGCTGAAGAGCACAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103175869 Original CRISPR GCCCTTGGCCACTCTCCCAG AGG (reversed) Intergenic
No off target data available for this crispr