ID: 1103175874

View in Genome Browser
Species Human (GRCh38)
Location 12:118862621-118862643
Sequence CAGCCTCCATCCCACGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103175874_1103175876 11 Left 1103175874 12:118862621-118862643 CCAAGGGCGTGGGATGGAGGCTG No data
Right 1103175876 12:118862655-118862677 TCCTGGCTAATTTTCCTCCCAGG No data
1103175874_1103175875 -6 Left 1103175874 12:118862621-118862643 CCAAGGGCGTGGGATGGAGGCTG No data
Right 1103175875 12:118862638-118862660 AGGCTGAAGAGCACAACTCCTGG No data
1103175874_1103175878 23 Left 1103175874 12:118862621-118862643 CCAAGGGCGTGGGATGGAGGCTG No data
Right 1103175878 12:118862667-118862689 TTCCTCCCAGGATTCCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103175874 Original CRISPR CAGCCTCCATCCCACGCCCT TGG (reversed) Intergenic
No off target data available for this crispr