ID: 1103176103

View in Genome Browser
Species Human (GRCh38)
Location 12:118864833-118864855
Sequence GGGCTGATGAGACCAATATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103176095_1103176103 9 Left 1103176095 12:118864801-118864823 CCAAGCCCTAGAGTTGACCCATC No data
Right 1103176103 12:118864833-118864855 GGGCTGATGAGACCAATATCAGG No data
1103176101_1103176103 -8 Left 1103176101 12:118864818-118864840 CCCATCTGTAAAATGGGGCTGAT No data
Right 1103176103 12:118864833-118864855 GGGCTGATGAGACCAATATCAGG No data
1103176096_1103176103 4 Left 1103176096 12:118864806-118864828 CCCTAGAGTTGACCCATCTGTAA No data
Right 1103176103 12:118864833-118864855 GGGCTGATGAGACCAATATCAGG No data
1103176097_1103176103 3 Left 1103176097 12:118864807-118864829 CCTAGAGTTGACCCATCTGTAAA No data
Right 1103176103 12:118864833-118864855 GGGCTGATGAGACCAATATCAGG No data
1103176102_1103176103 -9 Left 1103176102 12:118864819-118864841 CCATCTGTAAAATGGGGCTGATG No data
Right 1103176103 12:118864833-118864855 GGGCTGATGAGACCAATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103176103 Original CRISPR GGGCTGATGAGACCAATATC AGG Intergenic
No off target data available for this crispr