ID: 1103177229

View in Genome Browser
Species Human (GRCh38)
Location 12:118875088-118875110
Sequence GCTGCTTAACTAGCAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103177222_1103177229 28 Left 1103177222 12:118875037-118875059 CCAATCAACTAGAGCCAGGGGGT No data
Right 1103177229 12:118875088-118875110 GCTGCTTAACTAGCAGAGACTGG No data
1103177226_1103177229 14 Left 1103177226 12:118875051-118875073 CCAGGGGGTGGGAAGAATGGATA No data
Right 1103177229 12:118875088-118875110 GCTGCTTAACTAGCAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103177229 Original CRISPR GCTGCTTAACTAGCAGAGAC TGG Intergenic
No off target data available for this crispr