ID: 1103179593

View in Genome Browser
Species Human (GRCh38)
Location 12:118898450-118898472
Sequence ATGTTTAAGTGGAGTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103179586_1103179593 11 Left 1103179586 12:118898416-118898438 CCTGAGAATTTAGGAAAGACAGC No data
Right 1103179593 12:118898450-118898472 ATGTTTAAGTGGAGTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103179593 Original CRISPR ATGTTTAAGTGGAGTGTGGA AGG Intergenic
No off target data available for this crispr