ID: 1103180408

View in Genome Browser
Species Human (GRCh38)
Location 12:118906401-118906423
Sequence TGTTACACCTTGGGAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103180408_1103180413 15 Left 1103180408 12:118906401-118906423 CCAGTGTTTCCCAAGGTGTAACA No data
Right 1103180413 12:118906439-118906461 AAAGCAGAACAGAAGTGCAAAGG No data
1103180408_1103180414 22 Left 1103180408 12:118906401-118906423 CCAGTGTTTCCCAAGGTGTAACA No data
Right 1103180414 12:118906446-118906468 AACAGAAGTGCAAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103180408 Original CRISPR TGTTACACCTTGGGAAACAC TGG (reversed) Intergenic
No off target data available for this crispr