ID: 1103180913

View in Genome Browser
Species Human (GRCh38)
Location 12:118910575-118910597
Sequence ATTTATGCAGGAATAATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103180913_1103180915 2 Left 1103180913 12:118910575-118910597 CCAGGAATTATTCCTGCATAAAT No data
Right 1103180915 12:118910600-118910622 AGAGATAGTTTTTCAGCAGAAGG No data
1103180913_1103180916 6 Left 1103180913 12:118910575-118910597 CCAGGAATTATTCCTGCATAAAT No data
Right 1103180916 12:118910604-118910626 ATAGTTTTTCAGCAGAAGGCAGG No data
1103180913_1103180917 9 Left 1103180913 12:118910575-118910597 CCAGGAATTATTCCTGCATAAAT No data
Right 1103180917 12:118910607-118910629 GTTTTTCAGCAGAAGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103180913 Original CRISPR ATTTATGCAGGAATAATTCC TGG (reversed) Intergenic
No off target data available for this crispr