ID: 1103180917

View in Genome Browser
Species Human (GRCh38)
Location 12:118910607-118910629
Sequence GTTTTTCAGCAGAAGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103180914_1103180917 -3 Left 1103180914 12:118910587-118910609 CCTGCATAAATCAAGAGATAGTT No data
Right 1103180917 12:118910607-118910629 GTTTTTCAGCAGAAGGCAGGTGG No data
1103180913_1103180917 9 Left 1103180913 12:118910575-118910597 CCAGGAATTATTCCTGCATAAAT No data
Right 1103180917 12:118910607-118910629 GTTTTTCAGCAGAAGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103180917 Original CRISPR GTTTTTCAGCAGAAGGCAGG TGG Intergenic
No off target data available for this crispr