ID: 1103180917 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:118910607-118910629 |
Sequence | GTTTTTCAGCAGAAGGCAGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1103180914_1103180917 | -3 | Left | 1103180914 | 12:118910587-118910609 | CCTGCATAAATCAAGAGATAGTT | No data | ||
Right | 1103180917 | 12:118910607-118910629 | GTTTTTCAGCAGAAGGCAGGTGG | No data | ||||
1103180913_1103180917 | 9 | Left | 1103180913 | 12:118910575-118910597 | CCAGGAATTATTCCTGCATAAAT | No data | ||
Right | 1103180917 | 12:118910607-118910629 | GTTTTTCAGCAGAAGGCAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1103180917 | Original CRISPR | GTTTTTCAGCAGAAGGCAGG TGG | Intergenic | ||
No off target data available for this crispr |