ID: 1103182440

View in Genome Browser
Species Human (GRCh38)
Location 12:118925444-118925466
Sequence TATTAATCCAGAATCTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103182440_1103182447 27 Left 1103182440 12:118925444-118925466 CCTACATAGATTCTGGATTAATA No data
Right 1103182447 12:118925494-118925516 TTTGGGCTTCCTTATATGCTGGG No data
1103182440_1103182446 26 Left 1103182440 12:118925444-118925466 CCTACATAGATTCTGGATTAATA No data
Right 1103182446 12:118925493-118925515 TTTTGGGCTTCCTTATATGCTGG No data
1103182440_1103182444 10 Left 1103182440 12:118925444-118925466 CCTACATAGATTCTGGATTAATA No data
Right 1103182444 12:118925477-118925499 CACTTAGCTGAATTCCTTTTGGG No data
1103182440_1103182443 9 Left 1103182440 12:118925444-118925466 CCTACATAGATTCTGGATTAATA No data
Right 1103182443 12:118925476-118925498 ACACTTAGCTGAATTCCTTTTGG No data
1103182440_1103182449 29 Left 1103182440 12:118925444-118925466 CCTACATAGATTCTGGATTAATA No data
Right 1103182449 12:118925496-118925518 TGGGCTTCCTTATATGCTGGGGG No data
1103182440_1103182448 28 Left 1103182440 12:118925444-118925466 CCTACATAGATTCTGGATTAATA No data
Right 1103182448 12:118925495-118925517 TTGGGCTTCCTTATATGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103182440 Original CRISPR TATTAATCCAGAATCTATGT AGG (reversed) Intergenic
No off target data available for this crispr