ID: 1103183529

View in Genome Browser
Species Human (GRCh38)
Location 12:118936091-118936113
Sequence AAGGTGGGGAAGGAGCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103183529_1103183545 16 Left 1103183529 12:118936091-118936113 CCTCCTCGCTCCTTCCCCACCTT No data
Right 1103183545 12:118936130-118936152 ATTATAGTTGTGGGGGCAGGGGG No data
1103183529_1103183543 14 Left 1103183529 12:118936091-118936113 CCTCCTCGCTCCTTCCCCACCTT No data
Right 1103183543 12:118936128-118936150 AGATTATAGTTGTGGGGGCAGGG No data
1103183529_1103183544 15 Left 1103183529 12:118936091-118936113 CCTCCTCGCTCCTTCCCCACCTT No data
Right 1103183544 12:118936129-118936151 GATTATAGTTGTGGGGGCAGGGG No data
1103183529_1103183540 9 Left 1103183529 12:118936091-118936113 CCTCCTCGCTCCTTCCCCACCTT No data
Right 1103183540 12:118936123-118936145 GTGCCAGATTATAGTTGTGGGGG No data
1103183529_1103183537 6 Left 1103183529 12:118936091-118936113 CCTCCTCGCTCCTTCCCCACCTT No data
Right 1103183537 12:118936120-118936142 TGTGTGCCAGATTATAGTTGTGG No data
1103183529_1103183546 28 Left 1103183529 12:118936091-118936113 CCTCCTCGCTCCTTCCCCACCTT No data
Right 1103183546 12:118936142-118936164 GGGGCAGGGGGCACAGCTACCGG No data
1103183529_1103183538 7 Left 1103183529 12:118936091-118936113 CCTCCTCGCTCCTTCCCCACCTT No data
Right 1103183538 12:118936121-118936143 GTGTGCCAGATTATAGTTGTGGG No data
1103183529_1103183539 8 Left 1103183529 12:118936091-118936113 CCTCCTCGCTCCTTCCCCACCTT No data
Right 1103183539 12:118936122-118936144 TGTGCCAGATTATAGTTGTGGGG No data
1103183529_1103183542 13 Left 1103183529 12:118936091-118936113 CCTCCTCGCTCCTTCCCCACCTT No data
Right 1103183542 12:118936127-118936149 CAGATTATAGTTGTGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103183529 Original CRISPR AAGGTGGGGAAGGAGCGAGG AGG (reversed) Intergenic
No off target data available for this crispr