ID: 1103183536

View in Genome Browser
Species Human (GRCh38)
Location 12:118936110-118936132
Sequence AATCTGGCACACAGAAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103183536_1103183543 -5 Left 1103183536 12:118936110-118936132 CCTTGGCTTCTGTGTGCCAGATT No data
Right 1103183543 12:118936128-118936150 AGATTATAGTTGTGGGGGCAGGG No data
1103183536_1103183546 9 Left 1103183536 12:118936110-118936132 CCTTGGCTTCTGTGTGCCAGATT No data
Right 1103183546 12:118936142-118936164 GGGGCAGGGGGCACAGCTACCGG No data
1103183536_1103183544 -4 Left 1103183536 12:118936110-118936132 CCTTGGCTTCTGTGTGCCAGATT No data
Right 1103183544 12:118936129-118936151 GATTATAGTTGTGGGGGCAGGGG No data
1103183536_1103183542 -6 Left 1103183536 12:118936110-118936132 CCTTGGCTTCTGTGTGCCAGATT No data
Right 1103183542 12:118936127-118936149 CAGATTATAGTTGTGGGGGCAGG No data
1103183536_1103183545 -3 Left 1103183536 12:118936110-118936132 CCTTGGCTTCTGTGTGCCAGATT No data
Right 1103183545 12:118936130-118936152 ATTATAGTTGTGGGGGCAGGGGG No data
1103183536_1103183540 -10 Left 1103183536 12:118936110-118936132 CCTTGGCTTCTGTGTGCCAGATT No data
Right 1103183540 12:118936123-118936145 GTGCCAGATTATAGTTGTGGGGG No data
1103183536_1103183547 24 Left 1103183536 12:118936110-118936132 CCTTGGCTTCTGTGTGCCAGATT No data
Right 1103183547 12:118936157-118936179 GCTACCGGAGAAGTGTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103183536 Original CRISPR AATCTGGCACACAGAAGCCA AGG (reversed) Intergenic
No off target data available for this crispr