ID: 1103183539

View in Genome Browser
Species Human (GRCh38)
Location 12:118936122-118936144
Sequence TGTGCCAGATTATAGTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103183527_1103183539 10 Left 1103183527 12:118936089-118936111 CCCCTCCTCGCTCCTTCCCCACC No data
Right 1103183539 12:118936122-118936144 TGTGCCAGATTATAGTTGTGGGG No data
1103183532_1103183539 -2 Left 1103183532 12:118936101-118936123 CCTTCCCCACCTTGGCTTCTGTG No data
Right 1103183539 12:118936122-118936144 TGTGCCAGATTATAGTTGTGGGG No data
1103183534_1103183539 -7 Left 1103183534 12:118936106-118936128 CCCACCTTGGCTTCTGTGTGCCA No data
Right 1103183539 12:118936122-118936144 TGTGCCAGATTATAGTTGTGGGG No data
1103183535_1103183539 -8 Left 1103183535 12:118936107-118936129 CCACCTTGGCTTCTGTGTGCCAG No data
Right 1103183539 12:118936122-118936144 TGTGCCAGATTATAGTTGTGGGG No data
1103183531_1103183539 5 Left 1103183531 12:118936094-118936116 CCTCGCTCCTTCCCCACCTTGGC No data
Right 1103183539 12:118936122-118936144 TGTGCCAGATTATAGTTGTGGGG No data
1103183528_1103183539 9 Left 1103183528 12:118936090-118936112 CCCTCCTCGCTCCTTCCCCACCT No data
Right 1103183539 12:118936122-118936144 TGTGCCAGATTATAGTTGTGGGG No data
1103183533_1103183539 -6 Left 1103183533 12:118936105-118936127 CCCCACCTTGGCTTCTGTGTGCC No data
Right 1103183539 12:118936122-118936144 TGTGCCAGATTATAGTTGTGGGG No data
1103183526_1103183539 26 Left 1103183526 12:118936073-118936095 CCAAATTGTCTACAATCCCCTCC No data
Right 1103183539 12:118936122-118936144 TGTGCCAGATTATAGTTGTGGGG No data
1103183529_1103183539 8 Left 1103183529 12:118936091-118936113 CCTCCTCGCTCCTTCCCCACCTT No data
Right 1103183539 12:118936122-118936144 TGTGCCAGATTATAGTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103183539 Original CRISPR TGTGCCAGATTATAGTTGTG GGG Intergenic
No off target data available for this crispr