ID: 1103183547

View in Genome Browser
Species Human (GRCh38)
Location 12:118936157-118936179
Sequence GCTACCGGAGAAGTGTCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103183536_1103183547 24 Left 1103183536 12:118936110-118936132 CCTTGGCTTCTGTGTGCCAGATT No data
Right 1103183547 12:118936157-118936179 GCTACCGGAGAAGTGTCTAATGG No data
1103183535_1103183547 27 Left 1103183535 12:118936107-118936129 CCACCTTGGCTTCTGTGTGCCAG No data
Right 1103183547 12:118936157-118936179 GCTACCGGAGAAGTGTCTAATGG No data
1103183534_1103183547 28 Left 1103183534 12:118936106-118936128 CCCACCTTGGCTTCTGTGTGCCA No data
Right 1103183547 12:118936157-118936179 GCTACCGGAGAAGTGTCTAATGG No data
1103183541_1103183547 8 Left 1103183541 12:118936126-118936148 CCAGATTATAGTTGTGGGGGCAG No data
Right 1103183547 12:118936157-118936179 GCTACCGGAGAAGTGTCTAATGG No data
1103183533_1103183547 29 Left 1103183533 12:118936105-118936127 CCCCACCTTGGCTTCTGTGTGCC No data
Right 1103183547 12:118936157-118936179 GCTACCGGAGAAGTGTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103183547 Original CRISPR GCTACCGGAGAAGTGTCTAA TGG Intergenic
No off target data available for this crispr