ID: 1103189903

View in Genome Browser
Species Human (GRCh38)
Location 12:118992468-118992490
Sequence CAGAACTTCCAGCTGATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103189897_1103189903 30 Left 1103189897 12:118992415-118992437 CCTGTGCCTAGCAGAGCAGGTGA 0: 1
1: 0
2: 4
3: 23
4: 234
Right 1103189903 12:118992468-118992490 CAGAACTTCCAGCTGATAAAGGG 0: 1
1: 0
2: 4
3: 28
4: 243
1103189898_1103189903 24 Left 1103189898 12:118992421-118992443 CCTAGCAGAGCAGGTGAGCAGCT 0: 1
1: 0
2: 3
3: 25
4: 259
Right 1103189903 12:118992468-118992490 CAGAACTTCCAGCTGATAAAGGG 0: 1
1: 0
2: 4
3: 28
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103189903 Original CRISPR CAGAACTTCCAGCTGATAAA GGG Intronic
900869469 1:5291752-5291774 CAGAAGATCTAGCTGATAAGGGG + Intergenic
901346656 1:8550500-8550522 CAGAACTTGCAGGAGCTAAAGGG + Intronic
902571552 1:17350295-17350317 CAGCACTTCCTGCAGATAGAAGG + Intronic
904341350 1:29836961-29836983 GAGAAGTTCCAGCTGATGCAAGG - Intergenic
904375773 1:30081492-30081514 AAGGACTTCCAGCTAATGAAGGG - Intergenic
909672987 1:78209864-78209886 CAGAACTGTTAGCTAATAAATGG - Intergenic
910074062 1:83256640-83256662 CAGAAGTTCCAGAGGATGAATGG + Intergenic
910337821 1:86154893-86154915 CAGATCTTCCCGCTGATCAGGGG - Intronic
910606234 1:89087796-89087818 CAGAACATCTAACTGGTAAAAGG - Intergenic
911110652 1:94180945-94180967 CAGGACTCTCAGCTGAAAAATGG - Intronic
913225686 1:116696246-116696268 CAGGACTTACAGCTTATAATGGG + Intronic
916476428 1:165173722-165173744 CAGAACTAGGAGCTAATAAATGG + Intergenic
916761493 1:167821549-167821571 CAGAACTGCCTGCTGCTGAATGG + Intronic
919100241 1:193087443-193087465 AAGAACTTTCAACTAATAAAGGG - Intronic
919121370 1:193344911-193344933 CAGTAGTTGCAGCTGAAAAATGG + Intergenic
919362994 1:196618609-196618631 CACAACTTCCAAGTGTTAAATGG + Intergenic
919653433 1:200173977-200173999 GAAAACTTCCAGCTGGTAGAAGG + Exonic
920970803 1:210742331-210742353 CAGGACTTCCAGCTGAATGAAGG - Intronic
921666608 1:217880141-217880163 CAGAACTATGAGCTAATAAAGGG + Intergenic
921826303 1:219675732-219675754 CAGAACTTGCAACTGATGACCGG - Intergenic
922422674 1:225470253-225470275 CAGAACTTCGAGATGATAAGTGG + Intergenic
923043649 1:230338248-230338270 CAGAACTATGAGCTCATAAACGG - Intronic
924868386 1:248011736-248011758 CAGAAATTGCAGCAGAGAAAGGG - Intronic
1065394447 10:25218820-25218842 AACAACTTCCAGCAGATAAAGGG - Intronic
1065634556 10:27717271-27717293 CAGAACTTTGGGCTCATAAATGG + Intronic
1067534654 10:47099997-47100019 CAGACCTTCCATCTGAGAGAAGG + Intergenic
1067565419 10:47332528-47332550 GAGAACATCCTCCTGATAAATGG - Intergenic
1067566454 10:47341431-47341453 AAGAATTTTCAACTGATAAAGGG + Intergenic
1067805536 10:49390223-49390245 GAGAGCTTCCAGCTGGTAAAAGG + Exonic
1068611247 10:59062729-59062751 AAGAACCACCAGCTGGTAAATGG + Intergenic
1068706181 10:60078641-60078663 CAGAAATTCCCTCTTATAAAGGG - Intronic
1069390919 10:67934023-67934045 CAGAAATTCCCGCTATTAAAAGG + Intronic
1070763348 10:79040010-79040032 CAGATCTTACAGATGTTAAAAGG + Intergenic
1072043097 10:91628026-91628048 CAGAACTTCCAGCTGCACAGAGG - Intergenic
1074220743 10:111435340-111435362 CAGAACTTCCTGCTGGTAAATGG - Intergenic
1077535014 11:3119829-3119851 CAGAGCTGCCAGCTAAGAAAGGG - Intronic
1077988289 11:7377590-7377612 AATAAGTTCCTGCTGATAAAAGG + Intronic
1078480913 11:11674592-11674614 CAGATCTTCCACCTGAGATATGG - Intergenic
1079344849 11:19642917-19642939 CAGAACTACCACCTGATGCAAGG - Intronic
1080857195 11:36122399-36122421 CAGATTTTCCATCTGAAAAATGG + Intronic
1084652338 11:70496550-70496572 CAGAACTTCCACCAGATTCAGGG - Intronic
1085374362 11:76045191-76045213 CAGAGGTGCCAGCTGAAAAAAGG + Intronic
1088862199 11:113811251-113811273 AAGAACTTACAGCTGTGAAAAGG - Intronic
1089673224 11:120071684-120071706 TAGTACTTCCAGCTCATGAATGG + Intergenic
1090664646 11:128906397-128906419 CAGAACTGTGAGCTGATAAGTGG - Intronic
1092712346 12:11352663-11352685 CTGAACTTTCAGCAGCTAAATGG - Intronic
1092716082 12:11392383-11392405 CTGAACTTTCAGCAGCTAAATGG - Intronic
1092874563 12:12836921-12836943 CAGATCATACAGCTGGTAAAGGG + Intergenic
1094157750 12:27355330-27355352 AAGAATTTCCAGCTGATTAAGGG - Intronic
1096357701 12:50956039-50956061 CAGAACTTTCATTTGATTAAGGG + Intronic
1096840817 12:54378548-54378570 CAGCAGTTCCATCAGATAAAGGG - Intronic
1097137635 12:56871906-56871928 AAGAAGTTGCAGCTGATTAAGGG + Intergenic
1097472497 12:60011931-60011953 CAGAACTTCCTGCTAATCAGTGG + Intergenic
1098216686 12:68227938-68227960 CAGATCTTCCTGCTTATCAAAGG - Intergenic
1099979267 12:89580283-89580305 CTGAACTTCGGGCTGAAAAAAGG + Intergenic
1100029077 12:90163980-90164002 CAGAACTTTAAGCTAATAAATGG + Intergenic
1100434282 12:94557917-94557939 AAGAACTTCTAAATGATAAAGGG - Intergenic
1101624381 12:106424514-106424536 AAAAAATTCCAGCTAATAAATGG - Intronic
1101673385 12:106896817-106896839 GAGAACTTGCAGGTGAGAAATGG - Intergenic
1103189903 12:118992468-118992490 CAGAACTTCCAGCTGATAAAGGG + Intronic
1105365627 13:19761781-19761803 CATAGCTTCCAGCGGATGAATGG - Intronic
1105847002 13:24301984-24302006 CAGTAATCCCAGCTGATAAATGG + Intronic
1106175157 13:27323843-27323865 CAAAACATACATCTGATAAAAGG + Intergenic
1109249426 13:60001232-60001254 CAGAACTTTCTGGTGGTAAATGG - Intronic
1111503810 13:89159893-89159915 CAGAACTGTGAGCTAATAAATGG + Intergenic
1111663883 13:91243651-91243673 CAGAACTGTGAGCTAATAAATGG - Intergenic
1112620264 13:101047452-101047474 CAGAACTGTGAGTTGATAAATGG - Intergenic
1114331824 14:21645168-21645190 CAGAACTACAAGCTAATATATGG - Intergenic
1114739460 14:25080467-25080489 CAGAACTGCCAGCTAACCAATGG - Intergenic
1114867025 14:26608336-26608358 CACCACTTCCAGCTGATTGATGG - Intergenic
1116543835 14:46136770-46136792 CAGCACTTCCAGAGGAAAAAAGG + Intergenic
1119991255 14:79200200-79200222 CAGGATTTCCCACTGATAAATGG - Intronic
1120303051 14:82732671-82732693 CAAAACTTCCAGCCCAGAAATGG - Intergenic
1121863869 14:97344133-97344155 CAGAACTGTGAGCTAATAAATGG + Intergenic
1202879184 14_KI270722v1_random:41569-41591 CAGAAATTCCAGTTTATATATGG + Intergenic
1123850161 15:24347227-24347249 CATGACTTCCAGATGATATAAGG + Intergenic
1123855104 15:24401780-24401802 CATGACTTCCAGATGATATAAGG + Intergenic
1123871130 15:24574723-24574745 CATGACTTCCAGATGATATAAGG + Intergenic
1123987153 15:25656121-25656143 CAGAAGTTACAGCTGAGAAGGGG + Intergenic
1124954868 15:34353770-34353792 CAGAACACACAGCTGATGAATGG + Exonic
1126696737 15:51332638-51332660 CATATCTTCCACCAGATAAAAGG - Intronic
1128250852 15:66163521-66163543 CAGAACTTCCAGGCGGGAAAGGG - Intronic
1130580772 15:85135197-85135219 CCGAACTTCCAGCTCCCAAATGG - Intronic
1130860921 15:87888891-87888913 CAGAAAGCCCAGCGGATAAAAGG - Intronic
1131348497 15:91674155-91674177 CAAAAATTCAAGGTGATAAAGGG - Intergenic
1132119380 15:99163524-99163546 CAGAACTGCAAGGTAATAAATGG + Intronic
1134798473 16:17063086-17063108 CAGAAATTCCAGCTGGAGAACGG - Intergenic
1137705455 16:50532711-50532733 CAGATATTCCAGCTGAGAACGGG - Intergenic
1137851763 16:51752572-51752594 CATATCTTTCAGCTGATTAACGG - Intergenic
1138050775 16:53775048-53775070 CAGAACTCCTAGCTGCAAAAGGG + Intronic
1139838425 16:69859117-69859139 CAGAACTGTGAGCTAATAAATGG - Intronic
1140438503 16:74968391-74968413 CAGAACTGTGAGCTAATAAATGG + Intronic
1140871504 16:79110807-79110829 CCCAACACCCAGCTGATAAAAGG - Intronic
1142134449 16:88445147-88445169 CAGTTCTTCCATCTGTTAAATGG + Intergenic
1144150529 17:12439165-12439187 CAGAGCTTGCAGCAGATAGAAGG - Intergenic
1145091510 17:19990036-19990058 GAGATCTTGCAGCTAATAAAAGG + Intergenic
1146643071 17:34555708-34555730 CAGAATGTCCAGCAGTTAAATGG + Intergenic
1147700851 17:42393854-42393876 AAGAACATACAGCTGGTAAATGG + Intergenic
1149306988 17:55357630-55357652 CAGAGCTTCCACCTTATAACTGG - Intergenic
1149415224 17:56452474-56452496 GAGAACTCCCAGCTGATCAGTGG - Intronic
1149469069 17:56901499-56901521 CTGAACCACAAGCTGATAAAAGG - Exonic
1149714527 17:58775476-58775498 CAGATCTTCCAGCAGTTACATGG + Intronic
1149841785 17:59971548-59971570 CAGAACCTACAGATGTTAAACGG - Intronic
1153078030 18:1188453-1188475 CAGAACTATGAGCTAATAAATGG - Intergenic
1153940417 18:9972079-9972101 CAGAGCTTCCAGTTGACAATGGG - Intergenic
1156477063 18:37412215-37412237 CAGAACTTCCAGCCCAGAGACGG + Intronic
1157749635 18:50166687-50166709 CAAAACTTCAAACTGATAAATGG - Intronic
1158131993 18:54162195-54162217 CAGAACTTTAAGCTAATAAATGG + Intronic
1160316460 18:77852431-77852453 AGCAACTTCCAGCTTATAAAAGG + Intergenic
1160543859 18:79640172-79640194 CACAACCTCCAGCTGAAAACAGG - Intergenic
1161523341 19:4738270-4738292 CAGCAATTACAGCTAATAAACGG - Intergenic
1162584033 19:11548152-11548174 CAGATCTTCCAGCTGATGCGTGG + Intronic
1163713835 19:18862869-18862891 CCCAACTTCCAGCTGGTGAATGG - Intronic
1164862899 19:31577081-31577103 CAGAACTTCCGGCTGGTGAAAGG + Intergenic
1166006199 19:39908860-39908882 TAGAACTTCCAGGTGGTACAAGG + Intronic
1202654804 1_KI270708v1_random:10577-10599 CAGAAATTCCAGTTTATATATGG + Intergenic
926926644 2:17994421-17994443 AGGAACTTCAATCTGATAAAAGG - Intronic
928995961 2:37291577-37291599 CAGGACTTCCAGGTGAGACAGGG + Intronic
929913406 2:46113524-46113546 CAGAGTTTCCAGCTCAAAAAGGG - Intronic
930009839 2:46928254-46928276 CAGAACTGTGAGATGATAAATGG - Intronic
932406214 2:71513910-71513932 CAGGATTTCCAGGTGATGAACGG + Exonic
933762928 2:85685976-85685998 CAGCATTTCAAGCTGACAAATGG + Intronic
936349396 2:111701502-111701524 CCGAAGTCCCAGCTGATAACTGG + Intergenic
936762826 2:115806478-115806500 CACACTTTCCAGTTGATAAATGG + Intronic
936997666 2:118432526-118432548 CAGAACTTTCACCTGTAAAAGGG - Intergenic
938463333 2:131511704-131511726 CAGAACCTCCAGCTGAGAAAAGG - Intergenic
939359007 2:141144493-141144515 TAGAACTTCCTGATAATAAAAGG - Intronic
939817644 2:146915786-146915808 CAGAATTTCTAGCTGTAAAATGG + Intergenic
940072392 2:149703170-149703192 CAGATTTCCCATCTGATAAATGG - Intergenic
940293514 2:152099298-152099320 CAGAGCTTCCAGAGGATGAAGGG + Intergenic
943398143 2:187368436-187368458 CAGAATTTCCATATGATGAAGGG + Intronic
943737665 2:191374611-191374633 CAGCACTTCCAGCTGGTACTGGG - Intronic
943860203 2:192851898-192851920 AAGAACTTCCACCAGAAAAAAGG + Intergenic
945000387 2:205344069-205344091 TAGAGCTTCCAGCGGATACATGG + Intronic
946379990 2:219340951-219340973 GGGAACTTCAATCTGATAAAAGG + Intergenic
946872663 2:224098422-224098444 CAGAACTGTGACCTGATAAATGG - Intergenic
946984461 2:225256560-225256582 CAGAACTGTGAGCTGATAAAAGG + Intergenic
1168834075 20:865381-865403 GATAACTTCCAGCTGATGGAAGG + Intergenic
1169052116 20:2588447-2588469 CAGAACTGTGAGCTAATAAATGG + Intronic
1169105653 20:2992154-2992176 GATCACTTCCAGCTGATAATGGG + Intronic
1172501725 20:35432554-35432576 CAAAGATTCCAGCTGAGAAAAGG + Intergenic
1174699066 20:52589650-52589672 CAGCTCTTCCAGCTGATGTAAGG + Intergenic
1175030476 20:55948707-55948729 GCCAACTTCTAGCTGATAAAGGG - Intergenic
1176640487 21:9299030-9299052 CAGAAATTCCAGTTTATATATGG + Intergenic
1177950223 21:27526656-27526678 GAGATCTGCCAGTTGATAAAGGG + Intergenic
1179055106 21:37924490-37924512 CAGAACTATGAGCTAATAAATGG - Intergenic
1180173370 21:46073398-46073420 CAGATCTTACAGATGTTAAAAGG + Intergenic
1180349514 22:11788413-11788435 CAGAAATTCCAGTTTATATATGG + Intergenic
1180388693 22:12203821-12203843 CAGAAATTCCAGTTTATATATGG - Intergenic
1180500457 22:15924672-15924694 CAGGACACCCAGCTGACAAAAGG - Intergenic
1181983073 22:26780036-26780058 CAGAACATCCAGCTGACCCATGG + Intergenic
1183664409 22:39239119-39239141 CAGAGCTGCCAGCAGATAATGGG + Intronic
1183763512 22:39847876-39847898 CAGAACTGCGAGATAATAAATGG - Intronic
1184319866 22:43732835-43732857 CAAGCCTTCCACCTGATAAATGG + Intronic
949140856 3:630855-630877 CACAACTTCCAGGTCAGAAATGG - Intergenic
954348078 3:50017678-50017700 CAAATCTTCCATCTGATAAAGGG - Intronic
955231634 3:57104573-57104595 CTGAACTTCCCTTTGATAAAAGG + Intronic
956518501 3:70078134-70078156 CAGAAGTTCCTTCTAATAAAGGG - Intergenic
956697337 3:71929663-71929685 CAGAACTTCTTGCTTATATATGG + Intergenic
958493844 3:94816387-94816409 CAGATCTTCCAGCCACTAAAAGG + Intergenic
958714321 3:97761801-97761823 CAGAAATTGCAGATGAAAAAAGG + Intergenic
959367931 3:105487361-105487383 CAGAACTTCCATCTAATAGATGG + Intronic
959571150 3:107885404-107885426 CAGAACTCTGAGCTCATAAATGG + Intergenic
964969579 3:162542980-162543002 CAGAACTGCCAGTTGCTAGAGGG - Intergenic
965068967 3:163892186-163892208 CAGAACTGTGAGCTAATAAATGG + Intergenic
965563495 3:170084900-170084922 CAGCACTTCCAGTTGACAAATGG - Exonic
965982523 3:174710913-174710935 CAGAACTGTGAGCTTATAAATGG + Intronic
1202746406 3_GL000221v1_random:105994-106016 CAGAAATTCCAGTTTATATATGG - Intergenic
968880338 4:3295254-3295276 CAGCGCTTCCGGCTGATAGAAGG + Intronic
969136067 4:5029732-5029754 CAGAGCTGCAAGCTGATAAATGG + Intergenic
970362736 4:15326168-15326190 GAGAACTTTGAGCTAATAAACGG - Intergenic
970996892 4:22278046-22278068 CAGAACTAAGAGCTGATAATGGG + Intergenic
973334625 4:48943404-48943426 CAGAACTGCAAGCTAATAAATGG + Intergenic
974223113 4:59002486-59002508 CACAACTTCAAGCTAACAAAAGG + Intergenic
974757395 4:66228195-66228217 CTGCACTTCCAGCTGAGATACGG + Intergenic
976877385 4:89871145-89871167 CAGAACTGTGAGCTGATAAATGG - Intergenic
977104293 4:92861209-92861231 CAGAACTGTGAGCTGATAAATGG - Intronic
977498655 4:97809834-97809856 TAGAACTGTGAGCTGATAAACGG + Intronic
978127103 4:105147451-105147473 CAGACCCTACAGCTGATAAAAGG - Intronic
978330131 4:107603419-107603441 CAGAGTTTCCACCTAATAAAAGG - Intronic
978822445 4:112980967-112980989 AAGAACTTACAGCTGATAAGAGG + Intronic
979058288 4:116021830-116021852 CAGAACTTGTAACTGATAAGCGG + Intergenic
979594323 4:122517107-122517129 CAGATCTTACAGCTATTAAAAGG - Intergenic
979832588 4:125318990-125319012 CACTACCTTCAGCTGATAAAAGG - Exonic
980252883 4:130340496-130340518 CAGAACTGTGAGCTAATAAATGG - Intergenic
981260501 4:142712934-142712956 CAGCTCTTCCACCTGATATATGG - Intronic
981299870 4:143175105-143175127 CAGCAATTCCAACTGATAGAGGG + Intergenic
982034980 4:151337320-151337342 CAGAACTGTCAGCTAATAAGTGG - Intergenic
984052012 4:174876025-174876047 CAGAACTTCCTGCTACTGAAAGG - Intronic
985056320 4:186038562-186038584 CTGAACTTCCAGATGATAATAGG - Intergenic
985327994 4:188794771-188794793 GAGCACTTTCAGCAGATAAAAGG + Intergenic
985920141 5:2964715-2964737 CAGAACTTTCAGCTGCTGAAGGG - Intergenic
986265673 5:6188181-6188203 CACAACTTTTAGCTGAAAAATGG - Intergenic
987748767 5:22011493-22011515 CAGATCTTCCAGAAGTTAAATGG - Intronic
988244386 5:28660628-28660650 CATTACTTTCAGCTGAGAAAGGG + Intergenic
989736522 5:44714528-44714550 CAGAACTCTCAGATAATAAATGG - Intergenic
989821702 5:45800712-45800734 CAGAAGTTCCAGCTGCAGAAAGG + Intergenic
990088439 5:52008808-52008830 AAAAATTTACAGCTGATAAATGG - Intronic
990990755 5:61681465-61681487 CTGAACTTCCCCCTGATGAAAGG + Intronic
991111808 5:62908802-62908824 TAGAATTTCGAGCTGATAAGTGG - Intergenic
993558189 5:89367816-89367838 CAGAACTATGAGATGATAAATGG + Intergenic
994138800 5:96319712-96319734 TAGAACTTCCAGATGATATTAGG + Intergenic
995760922 5:115560985-115561007 CAGAACTGTGAGCTAATAAATGG + Intergenic
996105157 5:119492625-119492647 CAGAAATTGCAGCTGATCTATGG + Intronic
997418040 5:133744228-133744250 CAGAAGTTCCAACTTAGAAAAGG - Intergenic
997909155 5:137852123-137852145 TACAACTTCAAGATGATAAAGGG + Intergenic
998196441 5:140076897-140076919 CAGACTTTTCAGCAGATAAATGG - Intergenic
998538741 5:142959334-142959356 CAGAACTATGAGCTCATAAATGG - Intronic
1000627598 5:163557036-163557058 GAGGAATTCCAGCTAATAAACGG - Intergenic
1000895423 5:166849212-166849234 CAGAACTTCCAGGTGAACAAGGG + Intergenic
1001119095 5:168964125-168964147 AAACACTTCCTGCTGATAAATGG + Intronic
1003145884 6:3510464-3510486 CAGAGCTTGCTGCTGATATACGG + Intergenic
1003879732 6:10469080-10469102 CAGAACTGTGAACTGATAAATGG - Intergenic
1004121173 6:12823676-12823698 CTGAAGCTCCAACTGATAAAGGG - Intronic
1004338888 6:14789593-14789615 AAGAACTTGCAGCTGGTTAATGG - Intergenic
1004897145 6:20159446-20159468 CAGAACTTCCTGCTTTTTAAAGG - Intronic
1006747088 6:36350619-36350641 CAGAAACTCCAGCTGCTAAGGGG - Intergenic
1007510059 6:42367801-42367823 AAGATCTCCCAGCTGAAAAATGG - Intronic
1007914488 6:45548530-45548552 CAGCATTTCATGCTGATAAAGGG - Exonic
1010939537 6:81899748-81899770 CAGATCTTCCAACTGTAAAATGG + Intergenic
1011484119 6:87824494-87824516 CAGTAATTCCAGCAAATAAAAGG + Intergenic
1011872413 6:91912361-91912383 CAGAAATTTCAGCAGATAAATGG - Intergenic
1013169489 6:107623568-107623590 TAGATCTTCCAGCTCACAAAAGG + Intronic
1013699454 6:112746976-112746998 CATAATTTCAAGTTGATAAAAGG + Intergenic
1014693504 6:124590833-124590855 CTGGAGTTCCAGCTGATAATTGG + Intronic
1016753588 6:147659493-147659515 CTCAACTTCTGGCTGATAAATGG + Intronic
1017999011 6:159561856-159561878 CAGAACATGTATCTGATAAAGGG - Intergenic
1019052350 6:169192781-169192803 CACATCTTCCAGCCGAGAAAAGG - Intergenic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1022435224 7:30377036-30377058 CAGACCTTCCAGCTAATAGTTGG + Intronic
1022589991 7:31652510-31652532 GAGAACCTCCAGCTGCTAAAAGG - Exonic
1022848596 7:34236450-34236472 ATGAACTTCCAGATGAGAAAAGG - Intergenic
1023392896 7:39727592-39727614 CAGAATTTCCTGCTGTTTAAAGG + Intergenic
1027291762 7:76721503-76721525 CAGAAGTTCCAGAGGATGAATGG + Intergenic
1027841423 7:83317132-83317154 CAGATCTTCTAGCAGATAGACGG - Intergenic
1028003313 7:85529439-85529461 CAGAACTATGAGCTAATAAATGG + Intergenic
1028026914 7:85854632-85854654 CAAAACTTATACCTGATAAAAGG - Intergenic
1028172832 7:87619074-87619096 CAGAACTTTCAGCTAATAAATGG + Intronic
1029678026 7:102085018-102085040 GAGAATTTCCATCTTATAAACGG - Intronic
1030339324 7:108358857-108358879 CAAAACTCCCAGCAGTTAAAGGG + Intronic
1030672148 7:112349627-112349649 TAGAAGAGCCAGCTGATAAATGG - Intergenic
1031129956 7:117821388-117821410 AAGAACTTCAAAGTGATAAAGGG - Intronic
1031734928 7:125347130-125347152 CAGTTATTCCAGCTGTTAAATGG + Intergenic
1035495903 7:159325888-159325910 CAGAACTTACAGGTGATATAAGG - Intergenic
1036100721 8:5780916-5780938 CAAAACATATAGCTGATAAAAGG - Intergenic
1039438279 8:37576738-37576760 CAGAACTTTGAGATAATAAATGG - Intergenic
1040434447 8:47376474-47376496 CAGAGCTGTGAGCTGATAAATGG + Intronic
1040826100 8:51622348-51622370 CAGAACTGTGAGCTAATAAATGG + Intronic
1041301236 8:56414123-56414145 CAGAACTACAAGCAGAAAAATGG - Intergenic
1042047638 8:64671789-64671811 CAGAAAACCCAGATGATAAAAGG + Intronic
1043610283 8:82054455-82054477 AAGAACTTCCAGCAGATATTTGG - Intergenic
1046285674 8:112090495-112090517 CAGATCTACAAGCTGATGAAAGG - Intergenic
1046691636 8:117292267-117292289 CAGAACTCCCAGCTAATAAATGG + Intergenic
1046706588 8:117460258-117460280 CAAAACTCCCAGATGATAAATGG - Intergenic
1047150192 8:122251857-122251879 TAGAACATCCAGCTAAAAAAGGG - Intergenic
1047451310 8:124967363-124967385 CAGAACTTCCAGCTGGAGGATGG - Intergenic
1047683031 8:127274470-127274492 CAGAACTACGAGATAATAAATGG + Intergenic
1048206712 8:132421393-132421415 CATAACTACCAGCTGACAAAAGG + Intronic
1050589231 9:7145360-7145382 CAGAACTTCCAGCCATTCAATGG - Intergenic
1053000166 9:34573582-34573604 CAGAACATCCATCTGATGAAGGG + Intronic
1055117717 9:72623670-72623692 CAGCACTAACAGCTGATACATGG - Intronic
1060755952 9:126213661-126213683 CAGAACTGTGAGCTAATAAATGG - Intergenic
1203715042 Un_KI270742v1:136087-136109 CAGAAATTCCAGTTTATATATGG - Intergenic
1186221330 X:7352499-7352521 CAAAACTTTCAGATGGTAAATGG - Exonic
1186950418 X:14618592-14618614 CAGAATTACAAGCTAATAAATGG - Intronic
1188716667 X:33466873-33466895 CTGAGTTTCCAGCTGACAAATGG + Intergenic
1188909506 X:35829044-35829066 CAGAACTACCAGGTGATTACAGG + Intergenic
1190470531 X:50774809-50774831 CAGAACCTTAATCTGATAAAAGG + Intronic
1192421848 X:71039709-71039731 CAGAACTTTCATATGTTAAATGG - Intergenic
1193436259 X:81478048-81478070 CAGATCTTCCAGGTGATGAGTGG - Intergenic
1193871862 X:86807958-86807980 CAGAACTTCCACGTGATATTAGG - Intronic
1197071579 X:122305135-122305157 CAGAATATCCAGCTGATTGATGG + Intergenic
1197825497 X:130585747-130585769 CAGAACTGTGAGCTAATAAATGG + Intergenic
1199581259 X:149362652-149362674 CTGGACTTCCAGCTGACAGATGG + Intergenic
1202177312 Y:22109726-22109748 CAGAACTTCCACCTGAACATTGG + Intergenic
1202214049 Y:22476658-22476680 CAGAACTTCCACCTGAACATTGG - Intergenic