ID: 1103197655

View in Genome Browser
Species Human (GRCh38)
Location 12:119059115-119059137
Sequence CCCAAACAGAAGTGGTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103197655 Original CRISPR CCCAAACAGAAGTGGTTACA GGG (reversed) Intronic
901387468 1:8920665-8920687 CCCAAGCAGATGGGATTACAGGG - Intergenic
901396748 1:8987354-8987376 CCCAAAGTGCTGTGGTTACAGGG - Intergenic
906266131 1:44431598-44431620 CACAAACAGAGCTGGTTAAATGG - Intronic
906398637 1:45488900-45488922 CCCAAAGAGCTGGGGTTACAGGG - Intronic
906795783 1:48695564-48695586 CCGAAATAGAACTGGTTAAAGGG - Intronic
907707717 1:56847162-56847184 GCCAAAACAAAGTGGTTACAGGG + Intergenic
909681341 1:78295043-78295065 GCCAAACTAAAGGGGTTACAGGG - Intergenic
912448534 1:109755823-109755845 ACAAAACAGAAGTGGTTATTAGG + Intronic
913361944 1:117990367-117990389 CCCTAACAAATGTGGTTAGATGG - Intronic
913519911 1:119635266-119635288 CCAGAACAAGAGTGGTTACAAGG + Intronic
917412775 1:174776848-174776870 CCCAAACAGAAGGATTTAAAAGG - Intronic
917849519 1:179048775-179048797 CCCAACCAGAAGGTGATACATGG + Intronic
918054841 1:181011827-181011849 CCCAAAGTGAAGTGCTCACACGG - Intronic
918695118 1:187535863-187535885 ACCAAAAAGAAGTGGTAGCAGGG - Intergenic
921151538 1:212406947-212406969 CCCAACCAGAAGTGCATAGATGG - Intronic
923687458 1:236163202-236163224 GCCAAAACAAAGTGGTTACAGGG - Intronic
1062767830 10:79263-79285 ACGAAACAGAAGTTGATACAAGG - Intergenic
1063210833 10:3879898-3879920 CAGAAACACAAGTGGTTAAATGG - Intergenic
1068554268 10:58440441-58440463 CCCAAACAGAAGGTGTTAAACGG + Intergenic
1072444064 10:95482689-95482711 ACCCCACAGAAGTTGTTACATGG + Intronic
1073236814 10:102023645-102023667 CCCAAAGAGAGGAGGTAACAAGG + Intronic
1080555855 11:33416675-33416697 TCCAAAGAGAATTGGTTCCAGGG - Intergenic
1082173293 11:49032105-49032127 CCCAAACAGAGCTGCTTAAAGGG - Intronic
1083484130 11:62972509-62972531 CCCAAACTTAAGTGTCTACAAGG + Intronic
1084670791 11:70605417-70605439 CCTAAACATGAGTGGTCACAGGG - Intronic
1085346764 11:75773224-75773246 CCCTAGCACAGGTGGTTACAGGG - Intronic
1085890446 11:80573041-80573063 CCCAAATCAAAGAGGTTACAGGG + Intergenic
1086605070 11:88686272-88686294 TCCAAAACAAAGTGGTTACAGGG - Intronic
1086692467 11:89803942-89803964 CCCAAACAGAGCTGCTTAAAGGG + Intronic
1086713331 11:90035717-90035739 CCCAAACAGAGCTGCTTAAAGGG - Intronic
1087142198 11:94775857-94775879 CCAAAACAGAAGTGGTAAAATGG - Intronic
1087544078 11:99561557-99561579 CCAAAAGAGAAGTGATTTCATGG + Intronic
1088218959 11:107546655-107546677 CCCAAATAAAAATGATTACAAGG - Intronic
1089405234 11:118192173-118192195 GCCAAAACAAAGTGGTTACAGGG - Intergenic
1089443046 11:118531929-118531951 CCCAAACAGAAGTGCAGACAGGG - Intronic
1090869951 11:130735384-130735406 ACCAACAGGAAGTGGTTACAAGG - Intergenic
1094242406 12:28243254-28243276 CCCATAGGGAAGTGGTTACTGGG + Intronic
1098932601 12:76437432-76437454 ACCTAACAGAAGAGGTAACACGG - Intronic
1100313222 12:93416989-93417011 CCCAAACAGAAGTGAGTTTAGGG + Intronic
1100577058 12:95901994-95902016 CAAAAACTGAAGTGGTTTCATGG - Intronic
1101745367 12:107537691-107537713 CCCAAAGAGAAGTAGTTTGAAGG - Intronic
1102366531 12:112341302-112341324 CTCAAACAGAAGTGCTGACCTGG - Intronic
1103197655 12:119059115-119059137 CCCAAACAGAAGTGGTTACAGGG - Intronic
1104498408 12:129262420-129262442 CCCAAACTCAAGTTTTTACAGGG + Intronic
1105679319 13:22709324-22709346 GCAGAAAAGAAGTGGTTACAGGG - Intergenic
1106180053 13:27362547-27362569 CCCAAACAGCAGCGGCGACAGGG - Intergenic
1106578763 13:30999928-30999950 CCCCAACAGCAGTGGTTTCTGGG - Intergenic
1109436097 13:62304927-62304949 CCAAAACAGAAGTGGTTTGGGGG + Intergenic
1112724070 13:102281861-102281883 CCCAAACAGTGGTGGCAACAAGG + Intronic
1117032724 14:51690950-51690972 CTCAAACAGTGATGGTTACATGG - Intronic
1117954443 14:61111691-61111713 CACAAACAGAAATGGCTAGATGG - Intergenic
1118486023 14:66215226-66215248 GCCAAAACGAAGGGGTTACAGGG + Intergenic
1119841533 14:77796928-77796950 CCCAAACTGTCGTGGTTACAGGG + Intergenic
1121483757 14:94297919-94297941 GCCTAAACGAAGTGGTTACAGGG + Intergenic
1121573514 14:94965095-94965117 CACCAACAGAAGTGCTTGCAAGG + Intergenic
1121677429 14:95765348-95765370 CCCAAACAGGAGGGGTTGGAAGG + Intergenic
1124860234 15:33432388-33432410 CCCAAACAGATGAGGCTACAGGG - Intronic
1129562314 15:76584183-76584205 CCCAAACATAAGTGAAAACAAGG - Intronic
1131934323 15:97486211-97486233 ACCACACAGAAGTGGTGATAAGG + Intergenic
1132046957 15:98572162-98572184 CCCAAGCAGCTGTGATTACAAGG - Intergenic
1132212488 15:100034697-100034719 CCCAAACAGAACTGGAGAAAGGG + Intronic
1132882762 16:2169764-2169786 CCCAAAGGGAGGTGGGTACATGG + Intronic
1135148857 16:19987924-19987946 CCCAAACTTCAGAGGTTACAAGG - Intergenic
1135628714 16:24018741-24018763 CCAACACACAAGTGTTTACATGG + Intronic
1137319364 16:47363859-47363881 ACCAAAGAGAAGTGTTTAAATGG - Intronic
1138241125 16:55427945-55427967 CCTAAACAGAAGTGGGTCAAAGG + Intronic
1138365831 16:56476157-56476179 CCCAAACAGAACAGGTTTCTGGG + Exonic
1139049071 16:63100511-63100533 AGCAAAAACAAGTGGTTACAGGG + Intergenic
1139094158 16:63684544-63684566 CCCATACAGAAGTGGGAACTGGG - Intergenic
1143811498 17:9475422-9475444 CCTACAAAGAAGTGGTTATAAGG + Intronic
1144466377 17:15500766-15500788 GCCAAGGAGAGGTGGTTACATGG + Intronic
1147130483 17:38405008-38405030 CGGAGACAGAAGTGGTTGCAAGG - Exonic
1153341164 18:3976355-3976377 CTCAAAAAAAAGTGGTTAAAAGG + Intronic
1159132286 18:64292596-64292618 CCCAACCTGAAATGGTTCCATGG + Intergenic
1159667888 18:71185728-71185750 CCCACACAGATATGGTAACAAGG - Intergenic
1163327360 19:16613763-16613785 CCATAACAGAAATGGTTGCAAGG - Intronic
928961783 2:36933848-36933870 CCCAAAGTGCAGGGGTTACAAGG - Intronic
929148441 2:38727089-38727111 CCCAAACAGATGGGATTACAGGG - Intronic
931091082 2:58887166-58887188 CCCTGACACAAGTGGTTAAATGG - Intergenic
939703928 2:145428836-145428858 TCCAGACAGATGTGGTTATAAGG + Intergenic
942362557 2:175187652-175187674 CCAAAGCAGAAATGCTTACAGGG + Intergenic
942805721 2:179929522-179929544 GCCAAAAAAAAGGGGTTACAGGG + Intergenic
943832974 2:192485747-192485769 CCCAAAACAAAGGGGTTACAGGG - Intergenic
945661915 2:212696858-212696880 CCAAAATAGAAGTGATTAAAAGG - Intergenic
946480852 2:220055329-220055351 GCCAAAACAAAGTGGTTACAGGG - Intergenic
1169556557 20:6757266-6757288 ACCAAACAGAAGTTTATACAAGG - Intergenic
1169766492 20:9153015-9153037 GCCAAAACGAAGGGGTTACAGGG - Intronic
1172527003 20:35606017-35606039 CCCAGAGAGGAGTGGTAACAAGG - Intergenic
1173226576 20:41165663-41165685 TCCAATGAGAAGTGGTTCCATGG + Exonic
1174450349 20:50616247-50616269 ACCACACAAAATTGGTTACAGGG + Intronic
1174610006 20:51791030-51791052 GCCCTACAGAGGTGGTTACAAGG + Exonic
1174888717 20:54365789-54365811 CCCAAACTGAAGTGGAAATATGG - Intergenic
1175008579 20:55711310-55711332 CCAAAACAAAGGGGGTTACAGGG - Intergenic
1177204772 21:17998138-17998160 GCCAAAGCAAAGTGGTTACAGGG + Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178468949 21:32874730-32874752 GCCAAAACGAAGGGGTTACAGGG + Intergenic
1181846126 22:25710149-25710171 CCCAAAGGGAACTGGCTACATGG - Intronic
950858352 3:16126197-16126219 AACAAACAGAAGTGCTTTCAAGG + Intergenic
951772433 3:26273481-26273503 CCCAAACAGAGTTTGGTACATGG - Intergenic
952153802 3:30621150-30621172 CCCATAGAGGAGTGGCTACATGG - Intronic
954011899 3:47648117-47648139 CCCAAACAGCTGAGATTACAGGG + Intronic
954759488 3:52863784-52863806 GCCAAAACAAAGTGGTTACAGGG + Intronic
956014008 3:64861995-64862017 GCCAAACAGAAGAGTTTACAGGG - Intergenic
956529676 3:70203884-70203906 CAGAAACAGAAGTGGGGACATGG + Intergenic
959771646 3:110106183-110106205 CCAAAACATAAGTCATTACATGG + Intergenic
960082538 3:113556614-113556636 CCAAACCAGAAGTGGTTTCCTGG + Intronic
960834151 3:121887523-121887545 CACTACCAGAATTGGTTACATGG + Intergenic
962560923 3:136605964-136605986 CACACACAGAAATGGTTAGAGGG - Intronic
962938334 3:140102276-140102298 CCCAAAGAGAAGTTGTACCAAGG + Intronic
963592987 3:147286474-147286496 CCCAGGCAGAAGTTGTTGCAGGG - Intergenic
964127237 3:153247749-153247771 CTCAGACAGAACTGGTTAAAGGG - Intergenic
964520608 3:157563008-157563030 GCCAAAACCAAGTGGTTACAGGG + Intronic
964733190 3:159889441-159889463 CTCTAACAGAAGTGGCCACAGGG + Intronic
964840978 3:160993455-160993477 TCCGAACAGAAGTGGTCACAAGG + Intronic
964910847 3:161777746-161777768 GCCAAAACAAAGTGGTTACAGGG - Intergenic
966599165 3:181758135-181758157 CCCAAACAGAACTGGGTAAAGGG + Intergenic
970160120 4:13179835-13179857 CCCAAACATCAGTAGTTTCAAGG + Intergenic
970222604 4:13825862-13825884 GCCAAAACCAAGTGGTTACAGGG - Intergenic
971646027 4:29204421-29204443 CCCAAAAAGTAGAGGTTCCAAGG + Intergenic
979938689 4:126731358-126731380 ACCAAAGAGAAGTAGTTACGGGG + Intergenic
981773007 4:148331677-148331699 ACTAAAGAGAAGTGGTGACAAGG + Intronic
981949706 4:150391341-150391363 ACCAAAAAGTAGTGGTTAAATGG - Intronic
982730851 4:158953855-158953877 GCCAAAACGAAGAGGTTACAGGG - Intronic
987043772 5:14087322-14087344 CCCAGATAGAAGTGGTTGGATGG - Intergenic
988808995 5:34766498-34766520 GCCAAAACAAAGTGGTTACAGGG - Intronic
990844495 5:60121968-60121990 GCCAAAACGAAGTGGTTACAGGG + Intronic
993893628 5:93505119-93505141 GCCAAAACAAAGTGGTTACAGGG + Intergenic
994637605 5:102362944-102362966 GCCAAAACGAAGGGGTTACAGGG + Intergenic
994990341 5:106988574-106988596 TCCAAACGGAGGTGGTTAGATGG + Intergenic
996210702 5:120805646-120805668 AACATACAGAAGTGGTTACAGGG + Intergenic
996590949 5:125147269-125147291 CCAACACAAAAGTGGTTTCATGG + Intergenic
996892286 5:128435985-128436007 CCTAAACAAAACTGTTTACATGG - Intronic
997827218 5:137116992-137117014 CCCAACCAGAAGTGGTCACTAGG - Intronic
999474779 5:151888576-151888598 CCCAAACTGAAGTGCAGACAGGG + Intronic
1000555571 5:162721529-162721551 CCCAAACACAAATGCTTTCATGG - Intergenic
1001584719 5:172826116-172826138 CTCAAACACAAGGGCTTACAGGG - Intergenic
1003346779 6:5276685-5276707 CCCAAACTGATGTGGTTCCCTGG + Intronic
1005764794 6:29000333-29000355 CCCAAACAGATCTGGTAAAAAGG + Intronic
1007950116 6:45864531-45864553 CCCAAAGGGCAGGGGTTACAGGG + Intergenic
1008756207 6:54797764-54797786 GCCAAAACAAAGTGGTTACAGGG - Intergenic
1010988272 6:82450728-82450750 CCCAAACAGCATTCGTGACATGG - Intergenic
1011003307 6:82615759-82615781 AACAAACCTAAGTGGTTACAAGG + Intergenic
1011716361 6:90109301-90109323 CACAAGAAGAAGTGGTTTCATGG - Intronic
1012141564 6:95632119-95632141 CCAAAACAAAAGTGGCTACATGG - Intergenic
1013935448 6:115587894-115587916 GCCAAAACAAAGTGGTTACAGGG - Intergenic
1014576595 6:123081736-123081758 GCCAAAACGAAGGGGTTACAGGG + Intergenic
1015175780 6:130306685-130306707 CCCAAAGATAAGTGTATACAGGG + Intronic
1019146443 6:169978209-169978231 CCCTAACAGAAGTGGGAACTCGG + Intergenic
1020039443 7:4990675-4990697 CCCAAAGAGCAGTGCTTCCATGG - Intronic
1020155861 7:5723776-5723798 CCCAAAGAGCAGTGTTTAGACGG + Intronic
1020345149 7:7154391-7154413 GCCAAAACAAAGTGGTTACAGGG - Intergenic
1021341744 7:19472377-19472399 CCAAAACAGAAGACATTACAAGG + Intergenic
1022985397 7:35649366-35649388 CACACACAGAAGTGTTTAGAAGG + Intronic
1023375204 7:39548994-39549016 CCCAAAGTGTAGTGATTACAGGG - Intergenic
1024767090 7:52672357-52672379 CCCATACAGAATAGGTCACATGG + Intergenic
1025766533 7:64459550-64459572 CTCAAACAGAAGATTTTACATGG - Intergenic
1026764619 7:73152720-73152742 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027041089 7:74962488-74962510 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027082548 7:75239885-75239907 CCCAAACAGAAATGCATTCAGGG + Intergenic
1027234408 7:76289554-76289576 CCCACACAGAAGTGGGAGCAGGG - Intergenic
1029954312 7:104621551-104621573 TCCAAACAGAGGTGCTGACATGG + Intronic
1030707588 7:112710612-112710634 CCCAAACAGAAGTGATAGCGAGG + Intergenic
1034320157 7:150172810-150172832 GCCAAAAGAAAGTGGTTACAGGG + Intergenic
1037024314 8:14014048-14014070 ACCAAACAGATATGGTTAAAGGG - Intergenic
1037117903 8:15247766-15247788 CCCAAAACAAAGGGGTTACAGGG - Intergenic
1038131955 8:24742362-24742384 CAAAACCTGAAGTGGTTACAAGG + Intergenic
1039857194 8:41425622-41425644 CCCAAGAGGAAGAGGTTACAGGG - Intergenic
1045732189 8:105255492-105255514 ACCAAAACAAAGTGGTTACAGGG + Intronic
1048783050 8:138022352-138022374 GCCAAAATGAAGGGGTTACAGGG - Intergenic
1049822797 8:144646273-144646295 CCCAAACAGGAGTGAGAACAAGG + Intergenic
1050217376 9:3341889-3341911 CCTTAAGAGAAATGGTTACATGG - Intronic
1050534141 9:6616928-6616950 ACCAAACAGAAATAGCTACAAGG + Intronic
1051894508 9:21974148-21974170 CCCAAAGTGAAGGGATTACAAGG + Intronic
1052018769 9:23500679-23500701 ACAGAACAGAAGTGGTTTCAAGG + Intergenic
1053054305 9:34985204-34985226 ACCAAACATAACTGGTTACCAGG + Intergenic
1053180376 9:35962915-35962937 CCCAATTAGAGGTGGTGACAGGG + Intergenic
1055364056 9:75525294-75525316 GCCAAAACAAAGTGGTTACAGGG - Intergenic
1055843204 9:80531042-80531064 GCCAAACCAAAGGGGTTACAGGG + Intergenic
1058166645 9:101626533-101626555 CCCAGAGAGAAGTGGTGAGAGGG + Intronic
1058693194 9:107536386-107536408 CCCAAACTGCTGGGGTTACATGG + Intergenic
1187797455 X:23019911-23019933 CTCAAACAGAAGGGGAAACAGGG + Intergenic
1189282324 X:39827645-39827667 ACAAACCAGAAGTGGTTATAGGG + Intergenic
1191599093 X:62983625-62983647 GCCAAAACGAAGGGGTTACAGGG + Intergenic
1192934850 X:75848949-75848971 CTAAAACAAAAGGGGTTACAAGG + Intergenic
1193995888 X:88365666-88365688 CCCAAACAGCAGAGGTCTCATGG - Intergenic
1194681391 X:96858385-96858407 CTCAAACAGATGTGGTGAAATGG + Intronic
1196411522 X:115424966-115424988 CCCAGAGAGAAGTGGATGCAGGG + Intergenic
1197289124 X:124633068-124633090 CCCAAAAGGAAGTATTTACAAGG - Intronic