ID: 1103198680

View in Genome Browser
Species Human (GRCh38)
Location 12:119068798-119068820
Sequence GGTGAGGCTTAGAAACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103198674_1103198680 25 Left 1103198674 12:119068750-119068772 CCAAGAGATAAAAGCACACTTGT 0: 1
1: 0
2: 1
3: 20
4: 381
Right 1103198680 12:119068798-119068820 GGTGAGGCTTAGAAACAGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 262
1103198677_1103198680 0 Left 1103198677 12:119068775-119068797 CCACTAATTGATCTTAAAAGGAA 0: 1
1: 0
2: 3
3: 14
4: 235
Right 1103198680 12:119068798-119068820 GGTGAGGCTTAGAAACAGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 262
1103198676_1103198680 1 Left 1103198676 12:119068774-119068796 CCCACTAATTGATCTTAAAAGGA 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1103198680 12:119068798-119068820 GGTGAGGCTTAGAAACAGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103198680 Original CRISPR GGTGAGGCTTAGAAACAGAG AGG Intronic
902250169 1:15149317-15149339 GGTTACCCTTAGAAACTGAGGGG - Intergenic
902407027 1:16189963-16189985 GGTGGGACTTGGAAGCAGAGCGG + Intergenic
902555183 1:17242699-17242721 ACTGAGGCTTAGAAGGAGAGTGG + Intronic
903288478 1:22291963-22291985 GGTGAGGCTCAGAAGGAGACAGG + Intergenic
903731171 1:25496567-25496589 TGTGAGGCTTTGGAACAAAGTGG + Intronic
905675277 1:39820382-39820404 AGTGAGGCCCAGAGACAGAGAGG - Intergenic
906076404 1:43055347-43055369 ACTGAGGCTTAGAACCAGAAAGG - Intergenic
906188593 1:43880958-43880980 GGTGAGGCAGCCAAACAGAGAGG - Intronic
908029146 1:59981568-59981590 GGTGAGGCTTGGCAAAAGAGTGG - Intergenic
909666773 1:78143066-78143088 TGTAAGACTTAGAAAAAGAGAGG + Intergenic
910534469 1:88280980-88281002 GCTGAGGCTTATAAACAGCAGGG + Intergenic
910572287 1:88718960-88718982 GGGGAGGGTAAGAAAGAGAGAGG - Intronic
910770970 1:90832292-90832314 CATGAAGCTTAGAAACTGAGAGG - Intergenic
911099635 1:94084854-94084876 GGTGGGGCTGAGAAGAAGAGTGG + Intronic
912370909 1:109173282-109173304 GAGGAGGCTTAGAAAGAGAGAGG + Intronic
912419038 1:109531110-109531132 ACTGAGGCAAAGAAACAGAGAGG + Intergenic
914505052 1:148281562-148281584 CGTGAGGCTCAGAAACAGGAGGG - Intergenic
914507512 1:148302586-148302608 CGTGAGGCTCAGAAACAGGAGGG + Intergenic
915973487 1:160370383-160370405 GGAGAGGCCGAGAGACAGAGAGG - Intronic
916239635 1:162625941-162625963 GTTGTGTGTTAGAAACAGAGAGG + Intergenic
919283061 1:195517566-195517588 GGAGAGGCTGAGACACAGAGAGG + Intergenic
922141369 1:222891197-222891219 GCTGAAGCATAGAAACTGAGAGG + Intronic
922831553 1:228556966-228556988 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922832031 1:228608948-228608970 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922832592 1:228611189-228611211 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922833152 1:228613430-228613452 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922833713 1:228615671-228615693 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922834272 1:228617912-228617934 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922834832 1:228620143-228620165 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922835381 1:228622346-228622368 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922835940 1:228624588-228624610 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922836499 1:228626828-228626850 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922837057 1:228629069-228629091 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922837616 1:228631311-228631333 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922838175 1:228633552-228633574 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922838734 1:228635777-228635799 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922839292 1:228638017-228638039 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922839853 1:228640248-228640270 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922840414 1:228642489-228642511 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922840976 1:228644720-228644742 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
1064974017 10:21094785-21094807 TGTGAGACTTAGAAGCAAAGAGG - Intronic
1065227237 10:23556660-23556682 GGAGAGGCTTAGCAGGAGAGTGG - Intergenic
1066437757 10:35409554-35409576 TGAGAGGCTGAGGAACAGAGAGG + Intronic
1067297256 10:44982036-44982058 GGTGAGGCTGAGACACAGCTAGG + Intronic
1071107639 10:82116961-82116983 GGTGAACCCTAGAAAGAGAGTGG - Intronic
1072426822 10:95337052-95337074 GGGGAGGCTGAGAGACAGGGAGG + Exonic
1072995499 10:100240107-100240129 GGTGAGAGTTTGAAAGAGAGAGG - Intronic
1074198213 10:111207898-111207920 TGGGGTGCTTAGAAACAGAGGGG + Intergenic
1074753310 10:116607418-116607440 GGAGAGGCTCAGAAAGACAGTGG + Intronic
1074831155 10:117250355-117250377 GCTGAGGTTCAGAGACAGAGTGG - Intronic
1075370090 10:121928192-121928214 GGTGAGGCGGAGAGACAGAGCGG + Intronic
1075601560 10:123773003-123773025 GGTGATGCTCACAATCAGAGAGG - Intronic
1075801215 10:125154724-125154746 GGTGAGGGTTAGAAAGTGAGGGG + Intronic
1076366521 10:129924517-129924539 GGTGTGGATGAGAAACAGTGCGG + Intronic
1077219445 11:1409161-1409183 GGCGGGGCAGAGAAACAGAGAGG - Intronic
1077866545 11:6226259-6226281 GGTGAGTCTTATAAAGGGAGGGG + Intronic
1078617449 11:12879150-12879172 GGAGAGGCTCAGAAGCAGCGGGG - Intronic
1083365973 11:62141625-62141647 GGGGAGCCTTAGGAAGAGAGTGG + Intronic
1083619087 11:64040228-64040250 GGTGAGGTCAAGTAACAGAGGGG + Intronic
1085659074 11:78346003-78346025 AGTGAGACTTAGGAAAAGAGTGG - Intronic
1085681037 11:78575033-78575055 GGTGAGGCTGAGAAACTGAGAGG + Intergenic
1090214613 11:124950818-124950840 GGTGAGGTTAAGAAAAAGGGAGG - Intergenic
1091613130 12:2028616-2028638 GGAGAGGCTGTGACACAGAGAGG + Intronic
1092138470 12:6166540-6166562 GAGGAGCCTTAGAAACAGAGAGG + Intergenic
1092959682 12:13584172-13584194 GGTGAGTTTTAGAAACTGCGAGG - Intronic
1093155409 12:15678342-15678364 GGTGGGTATTAGAAACAAAGAGG + Intronic
1093428389 12:19055182-19055204 GGCAAGGCTTGGGAACAGAGAGG - Intergenic
1094243828 12:28262931-28262953 GGTTAGGCTATGAAACAGAGAGG - Intronic
1095643102 12:44507810-44507832 GGTGAGGCAGTGAGACAGAGAGG + Intergenic
1096712410 12:53467023-53467045 GGTAAGGGTTAGAAATAGAATGG - Intronic
1098111566 12:67127287-67127309 GGTTAGACTTAGAAGAAGAGAGG + Intergenic
1099826906 12:87787836-87787858 GGGGAAGCATAGAAGCAGAGTGG - Intergenic
1101006873 12:100409998-100410020 TGTGTGGCTTAGAAAGACAGTGG + Intronic
1102478209 12:113202429-113202451 GGTGGGGGATAGAAACAGAAGGG + Intronic
1103179681 12:118899243-118899265 GGTGGGGCTTTGGAACAGTGAGG + Intergenic
1103198680 12:119068798-119068820 GGTGAGGCTTAGAAACAGAGAGG + Intronic
1105061896 12:133160424-133160446 GGTGAGGGTTAAAGAGAGAGTGG + Intronic
1105585674 13:21740705-21740727 GGTGAGGGTTATATACAGAATGG + Intergenic
1106934265 13:34701112-34701134 AGTCAGGTTTAGAAACAGAAAGG + Intergenic
1107967730 13:45612793-45612815 AGGGAGGCATAGAATCAGAGAGG + Intronic
1110546983 13:76766655-76766677 GGTGAGGCCTAGTAACTGTGAGG + Intergenic
1112561545 13:100519660-100519682 CATGAGGCTTAGAGACAAAGGGG - Intronic
1117408184 14:55425563-55425585 GCTGAGGCAGAGAAAGAGAGTGG + Intronic
1118574756 14:67231149-67231171 GGTGAACCTTAGAAACAGGTTGG + Intergenic
1118598627 14:67455278-67455300 GGTGGGGATGAGAAACTGAGGGG - Intronic
1119168250 14:72513620-72513642 GATGAGGCCAAGAAACTGAGCGG - Intronic
1121889440 14:97575088-97575110 GGGGAGGCTTATAATCACAGTGG + Intergenic
1123713384 15:23007892-23007914 AGTGAGGCTGAGAGACACAGAGG + Intronic
1124818042 15:33016738-33016760 GGTGAGGCTTAAAAACTGTCAGG - Intronic
1125682017 15:41536907-41536929 TGTGAGGCTGAGAAGTAGAGAGG - Intronic
1128725293 15:69983458-69983480 GGAGAGGCTTCCCAACAGAGAGG + Intergenic
1129823424 15:78619694-78619716 GGTGTGGCTTAGGAACAAAGAGG - Intronic
1129887449 15:79048458-79048480 GGGGAAGCTGAGACACAGAGAGG - Intronic
1130696113 15:86133205-86133227 GCTGAGGCACAGAAAGAGAGAGG - Intergenic
1132234168 15:100206642-100206664 GGTGAGGCTGAGAAGAAGTGTGG + Intronic
1132679917 16:1135461-1135483 GGTGAGGCTGGGCCACAGAGGGG + Intergenic
1132692536 16:1188077-1188099 GCTGAGGCTTAGAAAGGGGGAGG + Intronic
1133108174 16:3527801-3527823 GCTGAGGCAGAGAGACAGAGAGG - Intronic
1133368153 16:5227567-5227589 GGTGGGGATTAGACAGAGAGAGG - Intergenic
1134314423 16:13105486-13105508 AGAGAGGCTTAGAAGGAGAGAGG + Intronic
1134446090 16:14332615-14332637 GGAGAAGCTTAGGCACAGAGAGG + Intergenic
1135205592 16:20481077-20481099 GGGGAAACTGAGAAACAGAGAGG - Intronic
1135595068 16:23735845-23735867 GGTGAGGAGTAGTTACAGAGAGG - Intergenic
1136018989 16:27428087-27428109 GTAGAGCCTCAGAAACAGAGGGG - Intronic
1137512440 16:49113560-49113582 GGTTATACTTTGAAACAGAGTGG + Intergenic
1138142456 16:54580535-54580557 GGAGAGGCTGAGGCACAGAGAGG + Intergenic
1138391478 16:56673366-56673388 GATGAGACTGAGACACAGAGAGG - Intronic
1140027469 16:71303661-71303683 AGAGAGGCATAGAGACAGAGAGG + Intergenic
1143611344 17:8019621-8019643 GGAGAGGCTGAGGCACAGAGAGG - Intronic
1144353398 17:14421532-14421554 GGTGATGCTATGATACAGAGTGG - Intergenic
1144675953 17:17161823-17161845 GGTGTGGTATAGAAACAGATGGG - Intronic
1146465909 17:33086590-33086612 GGTGAGGCTTAGAAGAGAAGAGG - Intronic
1146510916 17:33447527-33447549 AGTGAGGCTTAGCAAGGGAGAGG + Intronic
1147760619 17:42795446-42795468 GGTGAGGCCTAGAAAGTGGGGGG - Exonic
1148444316 17:47728252-47728274 TGTGAGTCTTATGAACAGAGGGG + Intergenic
1148466343 17:47867308-47867330 AATGAGGCTTAGAGAGAGAGTGG + Intergenic
1149242032 17:54662328-54662350 GATGAAGCTGAGAAACACAGAGG - Intergenic
1149701958 17:58662651-58662673 GGTGAGACTCACAAACTGAGGGG - Intronic
1149783414 17:59416144-59416166 GGTGAGGCGTATTGACAGAGAGG - Intergenic
1151945764 17:77319183-77319205 GGTGAAGCTTAAAGACAGAGAGG + Intronic
1151973871 17:77473199-77473221 GATGAGTCTGAGAAACAAAGAGG - Intronic
1152740630 17:82016914-82016936 GGGGAGGCGAAGACACAGAGTGG - Intronic
1154284915 18:13045129-13045151 GGTGAGATTAAGAAAAAGAGAGG - Intronic
1155257084 18:24008157-24008179 GGTGAGGGTGAGCTACAGAGGGG - Intronic
1155347336 18:24871274-24871296 GGTGAGGGATACAAAGAGAGAGG + Intergenic
1155792477 18:29991195-29991217 AGTGAGAATTAGAAACAGAGAGG - Intergenic
1157474327 18:48011735-48011757 GCTGAGGCTTAGATACATGGAGG - Intergenic
1160254321 18:77234839-77234861 AGTGAGGCCTAGAAACACGGAGG + Intergenic
1160423341 18:78764447-78764469 GATGAGGCTGAGAGACACAGGGG - Intergenic
1161454225 19:4362148-4362170 TGTGAGGCTGAGACCCAGAGGGG + Intronic
1162028512 19:7907501-7907523 GGTGAGGATGAGAAAGAGAACGG - Intronic
1163727107 19:18929062-18929084 GGTGAGGCTTGGAGTCCGAGGGG - Intronic
1164735893 19:30540586-30540608 GCTGAGCCTCAGAGACAGAGAGG + Intronic
1164923089 19:32104255-32104277 CCTGAAGCTTAGAAACAGAGAGG + Intergenic
1165332992 19:35151673-35151695 GGTGAGGGTGAGAAACTGTGTGG + Exonic
1167112025 19:47468215-47468237 GGTGAGGCTGAGGAGCAGAGGGG - Intronic
1167211734 19:48137807-48137829 GGTGAGCGTTAGACACAGGGAGG - Intronic
925975473 2:9139018-9139040 GGAAGGGCTTTGAAACAGAGAGG - Intergenic
927573285 2:24178761-24178783 GGTGAAGGCTAGACACAGAGTGG + Intronic
927853069 2:26511952-26511974 GGTGGGGCTCTGAGACAGAGGGG - Intronic
927912728 2:26912844-26912866 ACTGCAGCTTAGAAACAGAGGGG - Intronic
929428774 2:41869829-41869851 GGGGAGGCTTGAAAGCAGAGGGG + Intergenic
931878992 2:66546483-66546505 GGTGAGGCTTAGGCACTGAAAGG + Intronic
931910965 2:66899454-66899476 GGTGAAACTGAGAAAGAGAGAGG + Intergenic
934180297 2:89613068-89613090 GGTGAGGTCTAGTAACAGACTGG + Intergenic
934197200 2:89848449-89848471 GATGAGGCTGAGACACACAGAGG - Intergenic
934290596 2:91687331-91687353 GGTGAGGTCTAGTAACAGACTGG + Intergenic
934898708 2:98140413-98140435 GGAGAGGCTTAGAAGATGAGTGG - Intronic
936049809 2:109214171-109214193 GGTGAGGCTAAGACGCAGACTGG + Intronic
938302499 2:130227244-130227266 GGTGAGAGTGAGAAGCAGAGAGG - Intergenic
940284466 2:152020023-152020045 GTGGAGGCATAGAAACACAGTGG - Intronic
940820528 2:158350935-158350957 GGTGAGGATGAGTAACAGTGAGG - Intronic
941141990 2:161795107-161795129 GGGGAGGCACAGAAACACAGAGG - Intronic
943463262 2:188196036-188196058 GGTTAGGCTTGGAATTAGAGAGG + Intergenic
943911990 2:193580735-193580757 AGTGAAACTCAGAAACAGAGTGG + Intergenic
944624962 2:201561273-201561295 GATGAGTCTTAGAAACATAATGG + Intronic
945963858 2:216164660-216164682 GGAGGGGCTTAGAAGAAGAGGGG + Intronic
948775811 2:240288260-240288282 GATGAGCCTGAGCAACAGAGAGG + Intergenic
1170345942 20:15387343-15387365 GGAGAGGAATAGAAGCAGAGAGG - Intronic
1170399243 20:15961857-15961879 TGTGAGGCTTAGTAAGAGAGAGG + Intronic
1172182148 20:33010038-33010060 GGGGAGACTAAGAACCAGAGAGG + Intronic
1174207524 20:48851570-48851592 GGTAAGGCTGAGAAAGACAGTGG - Intergenic
1174223291 20:48975116-48975138 GGTGATGCTTTGAATCAGTGAGG - Intronic
1174295876 20:49544715-49544737 GGAGAAACTCAGAAACAGAGAGG + Intronic
1175712499 20:61232381-61232403 TGTGAGACTAAGAACCAGAGCGG - Intergenic
1177874656 21:26616960-26616982 GATGAAGTTTAGAAAGAGAGTGG - Intergenic
1179190744 21:39119761-39119783 GGTGAGGCAGAGAACAAGAGGGG + Intergenic
1180651099 22:17377890-17377912 GCTGAGGCTGAGAAACCCAGAGG - Intronic
1181925915 22:26358453-26358475 AGTGGAGCTTTGAAACAGAGTGG - Intronic
1183056832 22:35311945-35311967 GGTGGGGCTTAGAAGATGAGGGG + Intronic
949165286 3:933414-933436 TGGGAGGCTTAGAAATAGAAAGG - Intergenic
949560078 3:5193230-5193252 TCTGCCGCTTAGAAACAGAGTGG - Intronic
950240918 3:11369302-11369324 AGAGAGGTTTAGAACCAGAGGGG - Intronic
950453357 3:13078234-13078256 GTAGAGGCTTAGAAGCACAGGGG - Intergenic
950660065 3:14461715-14461737 GGTGAGGCTGAGAAAGTGAAAGG - Intronic
950921913 3:16703504-16703526 CTTGAGGCTGAGAAAGAGAGAGG - Intergenic
951987843 3:28640681-28640703 ACTGAGGTTCAGAAACAGAGAGG - Intergenic
952661703 3:35858344-35858366 GGTAAGGATCAAAAACAGAGGGG - Intergenic
953441985 3:42926152-42926174 GATGAAGCCTGGAAACAGAGTGG + Intronic
953530300 3:43734571-43734593 GGTGAGGTGTAAAAACAGAGAGG + Intergenic
955067208 3:55543850-55543872 GGTAAGGCTTCGAGAGAGAGTGG - Intronic
956872111 3:73428301-73428323 GGTGAGGATGTGGAACAGAGGGG - Intronic
960738688 3:120809192-120809214 GGTTAGCCATAGAAATAGAGAGG - Intergenic
961475476 3:127143347-127143369 GTTGAGCCTGAGGAACAGAGAGG + Intergenic
961821735 3:129578760-129578782 GGTGAGGCCCAGAGACAGGGAGG - Intronic
962935310 3:140075082-140075104 GGTGAGGCTCACAAAAAGAAAGG - Intronic
969828984 4:9780569-9780591 GGTGAGGTCTAGAAACAGACTGG - Intronic
970228617 4:13885727-13885749 GATGAGGTTGAGAGACAGAGGGG - Intergenic
970662484 4:18301614-18301636 GGGGAGGCTAAGTTACAGAGAGG - Intergenic
972146075 4:36027371-36027393 AGGGAGGCTTACAATCAGAGGGG - Intronic
972162185 4:36240535-36240557 AGTGAGGCTCAGGAAAAGAGAGG - Intronic
973119258 4:46499034-46499056 GCTGATGCTTAGGAATAGAGAGG - Intergenic
973740579 4:53915907-53915929 GATGAGGCTTCCAGACAGAGGGG - Intronic
973851076 4:54962216-54962238 GAGGAAGCTGAGAAACAGAGAGG - Intergenic
975197690 4:71544590-71544612 TGTGATGATTAGAACCAGAGTGG - Intronic
975845438 4:78520118-78520140 GGTGAGGTGTGGAAACTGAGTGG - Intronic
976036836 4:80833979-80834001 GGTGAGGTTTACAAGGAGAGAGG + Intronic
977018716 4:91731209-91731231 GGTGATGCTGGGAAACTGAGAGG - Intergenic
977174937 4:93808509-93808531 GGTGAGAGGTAGGAACAGAGTGG - Intergenic
977284989 4:95092675-95092697 GGTAAGGATTAGGAGCAGAGAGG + Intronic
978310824 4:107383303-107383325 TGTAAGGGTTAGAAACAGTGGGG - Intergenic
978634061 4:110782854-110782876 GGTGAGCATTAGAAACATAGTGG + Intergenic
978957865 4:114636883-114636905 TCTGAGGTTTAGAAACAAAGCGG - Intronic
983583674 4:169333913-169333935 GCAGAGGCTAAGAAAGAGAGAGG + Intergenic
984387081 4:179074453-179074475 GGAGAGGATTAGAAAAAGGGGGG + Intergenic
987673130 5:21039692-21039714 GGAGAGAGTTAGAAAAAGAGGGG + Intergenic
988594426 5:32579054-32579076 TGTTAGGCCTAGAGACAGAGAGG - Intronic
988972457 5:36483342-36483364 GGAGAGGCTCAGAAAGAGATTGG - Intergenic
990977892 5:61575053-61575075 GCTGTGGCTTGGAGACAGAGAGG + Intergenic
993123206 5:83800626-83800648 GGTAGGCCTGAGAAACAGAGAGG + Intergenic
993757789 5:91752424-91752446 TGGGAGGCTTGGAAACATAGTGG - Intergenic
994707454 5:103223586-103223608 GGAGAGGCTGAGATACCGAGAGG + Intergenic
997103373 5:130992942-130992964 GGGGAGGCATAGACACAGGGAGG - Intergenic
997926276 5:138033302-138033324 GGGGAGGTTGGGAAACAGAGAGG + Intronic
999540858 5:152571341-152571363 GATGAGGCTAAGAAACAGACAGG + Intergenic
999696842 5:154194673-154194695 AGTGAGGCTTAGATTCAGAAGGG + Intronic
1000152493 5:158517385-158517407 GGTGAGGATGAGAAGCACAGCGG + Intergenic
1001055658 5:168447854-168447876 AGAGAGGCAGAGAAACAGAGAGG - Intronic
1001180006 5:169511720-169511742 GGTCAGGCTTTGAATCAAAGAGG - Intergenic
1001547089 5:172577040-172577062 GGTGAGGGTCAGAGACTGAGTGG + Intergenic
1003682038 6:8266129-8266151 GGAAAGGTTTAGAAACAGTGAGG + Intergenic
1003888088 6:10539121-10539143 GGTGGGGTTTAGAAACAAACAGG + Intronic
1004603220 6:17170688-17170710 TGTGAGGCTTAGAGGCAGACAGG - Intergenic
1005286834 6:24336895-24336917 TGTGAGGATTAGAAACATATAGG - Intronic
1007311659 6:40951258-40951280 GGGGAGAGTTAGAACCAGAGAGG - Intergenic
1008595164 6:53034935-53034957 GGTAAGGCATGGAAACTGAGTGG + Intronic
1009656956 6:66559492-66559514 GGTGACTCTTAAAAACAGAAGGG - Intergenic
1011213364 6:84978106-84978128 GGTGAGGCGTGGGAACAAAGCGG - Intergenic
1013643065 6:112107073-112107095 TGTGATGTTTAGAAACTGAGTGG + Intergenic
1014138124 6:117910720-117910742 GGTAATGCTGAGACACAGAGTGG + Intronic
1015256412 6:131183821-131183843 GGTGAGGCTAAGTGACACAGGGG + Intronic
1016118852 6:140322990-140323012 TCTGAGGCTTAAAAACAGATGGG - Intergenic
1016698407 6:147025646-147025668 GGTGATACTTGGAAACACAGTGG - Intergenic
1018042160 6:159934360-159934382 GGAGAGGCTGAGACTCAGAGAGG + Intergenic
1022024859 7:26438148-26438170 GCAGAGGATTAGAAACAGACAGG - Intergenic
1022267870 7:28775295-28775317 GGTGAGGCGGGGAATCAGAGAGG - Intronic
1022501127 7:30883006-30883028 GGTGAGGCTCAAAGCCAGAGAGG - Intronic
1022562407 7:31363531-31363553 GGAGGGGGTTGGAAACAGAGAGG + Intergenic
1024122569 7:46260172-46260194 GGTGAGGCTGGGGAACAGAGTGG - Intergenic
1026230219 7:68476422-68476444 GGGGAGGTTTAGAAACTGAATGG - Intergenic
1026329729 7:69341329-69341351 AGTGAAGCTTTGTAACAGAGAGG + Intergenic
1028661839 7:93286483-93286505 GGTGAAGCTGAGAACCAGAGTGG + Intronic
1029326676 7:99815654-99815676 GGAGAGGATAAGAAAGAGAGAGG - Intergenic
1033033105 7:137846347-137846369 GGAGAGGCGTGGAAACAGAGAGG + Intronic
1033066347 7:138158641-138158663 GCTGAAGCTCAGAGACAGAGAGG - Intergenic
1034007217 7:147486323-147486345 GATGTGGGTTAGACACAGAGAGG - Intronic
1034442892 7:151096020-151096042 GGCGAAGCTAAGACACAGAGGGG - Intronic
1034701612 7:153101278-153101300 GGATAGGCTTAGCAGCAGAGGGG + Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035457506 7:159018278-159018300 GGTGAGACTGAGACACAGTGGGG - Intergenic
1035457517 7:159018326-159018348 GGTGAGACTGAGAAACAATGTGG - Intergenic
1035634940 8:1137458-1137480 GGTGAGGCTCAGACAGCGAGAGG - Intergenic
1036951994 8:13149514-13149536 GATGAGGAATAGACACAGAGAGG - Intronic
1038001409 8:23394955-23394977 GGTGAGGCTTAAAAACATTAGGG + Intronic
1038733274 8:30146569-30146591 GGTGAAGCTTAGTCCCAGAGAGG - Intronic
1039583971 8:38689845-38689867 GGTGAGGGTAAGGCACAGAGAGG - Intergenic
1039706066 8:40008819-40008841 TTTGAGGGTAAGAAACAGAGCGG - Intronic
1040301909 8:46192408-46192430 GGTGGGCCTTAGAAACTCAGGGG + Intergenic
1043157885 8:76808278-76808300 GGTGACTATTAGAAAAAGAGGGG - Intronic
1044900499 8:96938675-96938697 GGGGGCGCTTAGAAGCAGAGAGG - Intronic
1045052049 8:98336300-98336322 GGGGAGACTGAGAAACATAGGGG - Intergenic
1045280615 8:100746626-100746648 GGTGTGGCTGAGAGATAGAGAGG + Intergenic
1045861009 8:106815065-106815087 GGTGAGTCTTAGAAAGGGTGAGG + Intergenic
1046811817 8:118541283-118541305 GGTAAGGCTTAGAGCCAGAAAGG - Intronic
1048373240 8:133798804-133798826 GGTGAGGGTAAGAAACTTAGAGG + Intergenic
1049294258 8:141822401-141822423 GGGAAGGCTGAGAAAGAGAGTGG - Intergenic
1049306415 8:141906583-141906605 GTTGAGGGCTAGAAACAGACGGG + Intergenic
1050491042 9:6188121-6188143 GACGAGGCTGAGAAACATAGTGG + Intergenic
1052991564 9:34521905-34521927 GGTGAGGCCTAGGAGGAGAGAGG + Intronic
1053014826 9:34655754-34655776 GGTGAGGATTACGGACAGAGCGG - Intronic
1053162649 9:35824403-35824425 GCTGAGGCTTGGAAACAGCAGGG + Intronic
1055977375 9:81968348-81968370 GGTGGGGTTCAGAGACAGAGAGG - Intergenic
1059079555 9:111233800-111233822 GGAGAGGCTCAGAGAGAGAGAGG - Intergenic
1061661534 9:132133439-132133461 GGTTGGGCATAGAACCAGAGCGG + Intergenic
1062273663 9:135720914-135720936 GCTGGAGCTTTGAAACAGAGGGG + Intronic
1062571610 9:137188394-137188416 GGTGAGGCCTGGGAAGAGAGGGG - Exonic
1187236640 X:17474257-17474279 GGTTAGGCTCAGGAACAGAAGGG - Intronic
1187277959 X:17832729-17832751 GGTGAGCTTTAGAAACCGACAGG - Intronic
1187491375 X:19754821-19754843 GATCAGGCTTAGGAGCAGAGGGG + Intronic
1189116598 X:38349516-38349538 GGTGAGAGTGAGAGACAGAGAGG - Intronic
1190502443 X:51092957-51092979 TGTGAGTCTTAGAAAGACAGGGG + Intergenic
1192624937 X:72716535-72716557 GGTGAAGCGAAGAAAAAGAGAGG - Intergenic
1196601581 X:117606899-117606921 GGTGAGGCTAAGAACCAAAGAGG + Intergenic
1199233370 X:145464869-145464891 AGTGAGGTACAGAAACAGAGCGG + Intergenic
1199439082 X:147848167-147848189 GCAGAGGCCAAGAAACAGAGTGG + Intergenic