ID: 1103204013

View in Genome Browser
Species Human (GRCh38)
Location 12:119114150-119114172
Sequence GGTAATGAGGCACTGGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103204005_1103204013 25 Left 1103204005 12:119114102-119114124 CCTTATTTAGGTACTTAGTCTGA 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1103204013 12:119114150-119114172 GGTAATGAGGCACTGGCTATAGG 0: 1
1: 0
2: 1
3: 6
4: 110
1103204008_1103204013 -5 Left 1103204008 12:119114132-119114154 CCCAATCAGCCATGAGGTGGTAA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1103204013 12:119114150-119114172 GGTAATGAGGCACTGGCTATAGG 0: 1
1: 0
2: 1
3: 6
4: 110
1103204009_1103204013 -6 Left 1103204009 12:119114133-119114155 CCAATCAGCCATGAGGTGGTAAT 0: 1
1: 0
2: 1
3: 12
4: 88
Right 1103204013 12:119114150-119114172 GGTAATGAGGCACTGGCTATAGG 0: 1
1: 0
2: 1
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103204013 Original CRISPR GGTAATGAGGCACTGGCTAT AGG Intronic
902301748 1:15507031-15507053 GATAATGAGGCAGTGGCCACAGG + Exonic
907187987 1:52625791-52625813 GGTAAAGAGGCATTGGCTTCAGG - Intergenic
916318071 1:163472488-163472510 GGTAATGCACCACTGGCTGTGGG + Intergenic
916438988 1:164803676-164803698 GGAAATGAGGCACTAGGGATAGG + Intronic
917358930 1:174155667-174155689 GGAAAAGAGGCACTGGCTACTGG - Intergenic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
918487877 1:185048210-185048232 GGTGATGAGTCCCTGACTATAGG + Intronic
918623344 1:186630302-186630324 GGTAATGAGGAACTTGCTCATGG - Intergenic
920571326 1:207020194-207020216 AGGAATGAGGCACAGGCTTTTGG + Exonic
924650257 1:245919475-245919497 GGTAATGGGGCAGTCGCCATAGG - Intronic
1068880895 10:62047827-62047849 GGTATTGAAGGACTGGCTTTGGG - Intronic
1069096023 10:64261094-64261116 AGGAATGAGGAGCTGGCTATTGG + Intergenic
1073264165 10:102214568-102214590 GGTAGTGAGGGGCTGGCTAGGGG + Intergenic
1076226339 10:128779206-128779228 GGACAAGAGGCACTGGCTGTGGG - Intergenic
1078985877 11:16596522-16596544 GATGATGAGGAACTGGCTTTAGG - Intronic
1086543563 11:87941926-87941948 GGTAATGAGGCACTCCCTTCAGG - Intergenic
1088195465 11:107268932-107268954 TGCAATGATGCACTGGCTGTTGG - Intergenic
1088593533 11:111423042-111423064 GGTCAGGAGTCACTGGCTACAGG - Intronic
1091792680 12:3280785-3280807 GGTGAGGAGGCCCTGGCTCTAGG + Intronic
1093657741 12:21716486-21716508 GGAAATGAGGCAGTAGCTAGGGG + Intronic
1098086234 12:66847090-66847112 GGTTTTGAGGCAGTGGCTAGAGG - Intergenic
1103204013 12:119114150-119114172 GGTAATGAGGCACTGGCTATAGG + Intronic
1106741070 13:32642118-32642140 AGTAATGAGGAACTGACTGTAGG - Intronic
1107436928 13:40388580-40388602 GCAAATGAGGCACTGGCTCCAGG - Intergenic
1110403427 13:75121035-75121057 GGTAATGGGGCAATGGTTAGTGG - Intergenic
1110648194 13:77913944-77913966 GGTAGTCAAGCACTGGCTTTTGG + Intronic
1112723777 13:102278191-102278213 GGCAATGAGTCACAGGCTAAGGG + Intronic
1113292677 13:108923570-108923592 GGTAGTGAGGCGCTGGCCAGCGG - Intronic
1118328320 14:64796535-64796557 GGTAATGAGGGACATGCTTTGGG - Exonic
1120378968 14:83748649-83748671 GGGAATGAGGGAGTGGCTGTAGG - Intergenic
1121210461 14:92204555-92204577 GGTACTGAGGCATTGCCTTTTGG + Intergenic
1122243735 14:100386266-100386288 GTTAATGAGGCACTGACTTGGGG - Intronic
1124841395 15:33245170-33245192 GGGAATGAAGCACTGGGCATGGG - Intergenic
1126798161 15:52277340-52277362 GGTGATTAGGGACTGGGTATGGG - Intronic
1128236177 15:66068856-66068878 GGTAATGAGGCACAATGTATGGG + Intronic
1134165185 16:11924258-11924280 GGTGTTGAGGCATTGGCAATTGG - Intergenic
1134200824 16:12197242-12197264 GGCAATGAGGCTCTGGCTAAAGG + Intronic
1138557865 16:57783343-57783365 GGCAATGAGACACTGGTGATGGG + Intronic
1139268123 16:65658500-65658522 GGTAATGAGGAACTGCCTGCGGG - Intergenic
1140985474 16:80154390-80154412 GGTCAGGAGGCTTTGGCTATGGG - Intergenic
1146946672 17:36878134-36878156 GGTAATGGGGCATCTGCTATGGG - Intergenic
1152136885 17:78509641-78509663 GTTAATGCGCCACTGGCTACCGG - Intronic
1152986093 18:322726-322748 GGTAATGAGTCATTGTTTATAGG - Intronic
1154207007 18:12346086-12346108 GGAAATGAGGCGCTGGCAGTAGG - Intronic
1155575387 18:27240243-27240265 AGTAATGAGTCAATAGCTATAGG + Intergenic
1157396426 18:47345542-47345564 GTCAGTGGGGCACTGGCTATTGG + Intergenic
1159221415 18:65468984-65469006 GGTAATGTGGTACTGGCCCTGGG + Intergenic
1159629038 18:70728038-70728060 GGTTTTGAGGCCCTGGCTAGAGG + Intergenic
1160386359 18:78499314-78499336 GGAAATGTGGCACTGACTAGGGG - Intergenic
1162270258 19:9608677-9608699 GGGAATGAGGAACATGCTATTGG + Exonic
1162275548 19:9651239-9651261 GGGAATGAGGAACATGCTATTGG + Intronic
1162280082 19:9689116-9689138 GGGAATGAGGAACATGCTATTGG + Intergenic
1162283832 19:9722620-9722642 GGGAATGAGGAACATGCTATTGG + Intergenic
1164091705 19:21958900-21958922 GGTTATGAGGCACTGACTCGTGG - Intronic
1165680940 19:37774722-37774744 AGCATTGAGGCACAGGCTATAGG + Intronic
1167420683 19:49401253-49401275 GGAAATGAGGCAGGGGCTTTGGG - Intronic
925084669 2:1098909-1098931 TGAAATGAAACACTGGCTATGGG + Intronic
927914745 2:26928258-26928280 GCTAAGGAGGCACTGGATTTGGG + Exonic
929153612 2:38770221-38770243 GATAGACAGGCACTGGCTATAGG - Intronic
929687853 2:44049832-44049854 GGCAATTTGGGACTGGCTATTGG - Intergenic
929878297 2:45815116-45815138 GGTAATGAGGTTCTGGCTTGGGG - Intronic
930043068 2:47143966-47143988 AGTAATGATTCACTGGCTACAGG + Intronic
932173101 2:69575331-69575353 GGGAATGAGGCACTTGCTAGGGG + Intronic
934818374 2:97350272-97350294 GGGAATGAGGAACATGCTATTGG + Intergenic
939203521 2:139069936-139069958 GGCACTGAGAGACTGGCTATTGG + Intergenic
941237668 2:162995390-162995412 GGAAATGAGGAACTTGTTATTGG + Intergenic
947914704 2:233823667-233823689 GGAAATGAGGCACCGGGTGTGGG + Exonic
1169023545 20:2348468-2348490 TGTGATGAGGGACTGGCTATGGG + Intergenic
1177833633 21:26168218-26168240 GATAATGGGGCCTTGGCTATCGG - Intronic
1178682636 21:34685812-34685834 GGTATTGAGGCTCTGGCTAAGGG + Intronic
1181549333 22:23628004-23628026 GGTAGAGGGGCCCTGGCTATGGG - Intronic
951679701 3:25281980-25282002 ATTAATGAGGCACTGTCTTTGGG + Intronic
960571859 3:119192298-119192320 GGTAGGGAAGGACTGGCTATGGG - Intronic
961701570 3:128748659-128748681 GGTAATGAGGGAGTGGCTCCTGG + Intronic
963919491 3:150892167-150892189 TCCAATGAGGCACTGGCTGTGGG - Intronic
965857274 3:173103625-173103647 GGCAGTGGGGCACTGGCTCTAGG + Intronic
967361907 3:188640674-188640696 GGCAATGAGACTCTTGCTATGGG - Intronic
967946316 3:194806923-194806945 GGTGATGAGGCACTGGCTTTGGG + Intergenic
974094257 4:57345182-57345204 GGTTATGGGGTACTGGCTCTGGG - Intergenic
974577674 4:63749069-63749091 GGTCATGAGGCACAGCTTATTGG - Intergenic
976963862 4:91011747-91011769 GGGAATGAGGCACTGTGTAGTGG + Intronic
980448204 4:132938967-132938989 GGAAATGAGGCACTGTATAGTGG - Intergenic
982083387 4:151811457-151811479 AATAATGAAGCACAGGCTATAGG - Intergenic
989632944 5:43505726-43505748 GGTAATGCAGTAATGGCTATTGG - Exonic
990344628 5:54859495-54859517 GGGAATGAGGAACATGCTATTGG - Intergenic
994460911 5:100066707-100066729 GCTGATGAGGAACTGGCTCTCGG + Intergenic
994485059 5:100380135-100380157 GCTGATGAGGAACTGGCTCTCGG + Intergenic
996879413 5:128277947-128277969 GGTATTGATGCACTGACCATTGG + Exonic
1000365486 5:160486766-160486788 TGGAATGAGTCACTGGCTAAGGG - Intergenic
1003326596 6:5096581-5096603 GGGGATGAGACACTGGCTCTAGG + Intergenic
1012819460 6:104066824-104066846 GTTAATGAGGAACAGGCCATGGG - Intergenic
1014782041 6:125575626-125575648 GGTGCTGAGGAACTGCCTATGGG - Intergenic
1015048182 6:128804255-128804277 TCTAATGAGGCAAAGGCTATTGG + Intergenic
1015945253 6:138493643-138493665 GCTAATGAGGCACTGCCTCGGGG + Intronic
1018530925 6:164762601-164762623 GGAAATGAGGAACAGGTTATTGG + Intergenic
1019631112 7:2050352-2050374 GGGTCTGAGGCACTGGCTAGGGG - Intronic
1019634825 7:2069932-2069954 GGGACTGAGGCAGTGGCTGTGGG - Intronic
1023456703 7:40347304-40347326 GGAAATGAGGAACAGGTTATTGG + Intronic
1024705035 7:51947660-51947682 GGTGATGGGGCACTGGATGTGGG + Intergenic
1026467360 7:70665910-70665932 GGTAATGTTGCACTGTTTATGGG - Intronic
1033408385 7:141092860-141092882 GGACATGAGGAACTAGCTATGGG + Intronic
1033552674 7:142462191-142462213 GGAAATGAGGGACAAGCTATCGG + Intergenic
1034846975 7:154455343-154455365 GGCAGAGAGGCACTGGCTCTTGG + Intronic
1037814550 8:22105049-22105071 GGTGATGGGGCACTGGGCATTGG - Intergenic
1039029639 8:33295395-33295417 GGTAATGAGGAACATGTTATTGG - Intergenic
1040786320 8:51168534-51168556 GGCACTGAGGCACTTGCTAGTGG - Intergenic
1042831349 8:73032483-73032505 GATAATGTGGCACTTGATATTGG + Intronic
1046080402 8:109363353-109363375 GGTACAGAGGCACTGGGTCTGGG + Intronic
1046438436 8:114226943-114226965 AGTTTTGAGGCACTGGCTAGAGG + Intergenic
1048224433 8:132571039-132571061 GAGAATGAGGGACTGGTTATAGG - Intergenic
1052498928 9:29263513-29263535 GGTAGTGAGGATCTGGCTACAGG - Intergenic
1052704078 9:31972704-31972726 GCTAATGAGGCACAGGCAACAGG + Intergenic
1055332740 9:75200738-75200760 GCAAGTGAGGCACTTGCTATAGG + Intergenic
1057223120 9:93268389-93268411 GGTAAAGAGGCCCTGGTGATGGG - Intronic
1058211673 9:102177185-102177207 GGTGATGAGGCATTGGCTAGTGG + Intergenic
1193226037 X:78985470-78985492 GTTACTGAGGCACTGCCTAGAGG - Intergenic
1193491438 X:82153813-82153835 GATAATGAGACACTGACAATAGG + Intergenic
1197873695 X:131083284-131083306 TGTAGTGTGGCCCTGGCTATTGG + Intronic