ID: 1103206271

View in Genome Browser
Species Human (GRCh38)
Location 12:119131440-119131462
Sequence ATCAAGGCTCAGAGAGGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1210
Summary {0: 1, 1: 7, 2: 55, 3: 248, 4: 899}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103206267_1103206271 1 Left 1103206267 12:119131416-119131438 CCCTTCTACAGATAGGAAAGAAG 0: 1
1: 0
2: 9
3: 75
4: 653
Right 1103206271 12:119131440-119131462 ATCAAGGCTCAGAGAGGTTAAGG 0: 1
1: 7
2: 55
3: 248
4: 899
1103206268_1103206271 0 Left 1103206268 12:119131417-119131439 CCTTCTACAGATAGGAAAGAAGA 0: 1
1: 0
2: 1
3: 33
4: 334
Right 1103206271 12:119131440-119131462 ATCAAGGCTCAGAGAGGTTAAGG 0: 1
1: 7
2: 55
3: 248
4: 899

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103206271 Original CRISPR ATCAAGGCTCAGAGAGGTTA AGG Intronic
901218878 1:7570900-7570922 ACTGAGGCTCAGAGTGGTTAAGG - Intronic
901669792 1:10849558-10849580 AAACAGGCTCAGAGAGGTAACGG - Intergenic
902216604 1:14938155-14938177 ATTGAGGCTCAGAGGGGTTAAGG - Intronic
902246460 1:15124222-15124244 ACCGAGGCTCAGACAGGGTAAGG - Intergenic
902388267 1:16088407-16088429 ACCAAGGCTCAGAGAGGGCGTGG + Intergenic
902399053 1:16147736-16147758 ACCCAGGCACAGAGAGGTCAAGG + Intronic
902406027 1:16184142-16184164 ACGGAGGCTCAGAGAGGTAAAGG + Intergenic
902526384 1:17060613-17060635 ATGAATGCACAAAGAGGTTAAGG - Intergenic
902566312 1:17314013-17314035 ACTGAGGCTCAGAGAGGTAAGGG - Intronic
902613989 1:17613852-17613874 ACCGAGGCTCAGAGAGGCCAAGG - Intronic
902834836 1:19040356-19040378 ACTGAGGCTCAGAGAGGATAAGG + Intergenic
902889801 1:19434272-19434294 ATCGAGGCTCAGAGAGGTGAAGG - Intronic
903125214 1:21243167-21243189 ATCGAGGCTCAGTGAGGGAAAGG - Intronic
903340964 1:22654034-22654056 CAAGAGGCTCAGAGAGGTTAAGG + Intronic
903347377 1:22695295-22695317 GACAGGACTCAGAGAGGTTAAGG - Intergenic
903360330 1:22772970-22772992 ACCAAGGCTCAGAGAGATCAAGG - Intronic
903380175 1:22891129-22891151 ATGAAGACACAGAGAAGTTAAGG + Intronic
903414906 1:23175900-23175922 ATGGAGCCTCAGAGAGGGTAAGG + Intronic
903562433 1:24237923-24237945 ACCGAGGCTCAGAGAGGTTAAGG + Intergenic
903581991 1:24377872-24377894 GCTAAGGCTCAGAGAGGTGAAGG - Intronic
903607223 1:24583909-24583931 ACGGAGGCTCAGAGAGGTTAAGG - Intronic
903653189 1:24933272-24933294 AATGAGGCTCAGAGAGGTTTAGG - Intronic
903676696 1:25068824-25068846 AGGAAGGCTCAGAGAAGTTAGGG - Intergenic
903820137 1:26095443-26095465 ACTGAGGCACAGAGAGGTTAAGG - Intergenic
904134052 1:28297373-28297395 ACCAAGGCTCAAAGAGGTGAAGG + Intergenic
904259889 1:29282510-29282532 ACCGAGGCCCAGGGAGGTTAGGG + Intronic
904265507 1:29316426-29316448 ACTGAGGCTCAGAGAGGTAAAGG - Intronic
904293778 1:29504720-29504742 AGAAAGGCTCAGAGAGGTGACGG + Intergenic
904368576 1:30034260-30034282 ATGAAGACTCAGAGAGGTTGAGG - Intergenic
904421523 1:30397616-30397638 TTCAAGGCTGAGAGAGGTGGAGG + Intergenic
904532918 1:31181185-31181207 ACCGAGGCTCAGAGAGGGCAAGG + Exonic
904775616 1:32904373-32904395 ATTGAGGCCCAGAGAGGTAAAGG + Intergenic
904906058 1:33898059-33898081 ATTGAGGTTCAGAGAGGTGAAGG + Intronic
905011037 1:34747403-34747425 ACCAAGGCTGAGAGAGGCTGAGG - Intronic
905132800 1:35773870-35773892 ATGAAGGGACAGAGAGGTCAAGG - Intergenic
905300529 1:36983561-36983583 ATGGAGGCACAGAGAGGTCAAGG + Intronic
905343035 1:37292339-37292361 ACCGAGGCACAGAGAGCTTAAGG - Intergenic
905343963 1:37298928-37298950 ATAGAGGCTCAGAGAAGCTATGG + Intergenic
905360741 1:37418496-37418518 ACTGAGGCTCAGAGAGGTAACGG + Intergenic
905430677 1:37920776-37920798 ATTGAGGCTTAGAGAGGGTAGGG - Intronic
905453130 1:38069883-38069905 ACTGAGGCACAGAGAGGTTAAGG + Intergenic
905507063 1:38488534-38488556 ACAGAGGCTCAGAGTGGTTAGGG - Intergenic
905525817 1:38638655-38638677 ATCACAACTCAGAGAGGTAAAGG + Intergenic
905696900 1:39981119-39981141 CTCCAGGCTCAGAGAGGACAAGG + Intergenic
905783026 1:40729416-40729438 ATGAAGGCTGAGAGAGGTGAGGG - Intronic
905937106 1:41833478-41833500 AACAATGCTCAGAAAGGCTAAGG + Intronic
906084791 1:43122254-43122276 ACTGAGGCCCAGAGAGGTTAAGG - Intergenic
906128445 1:43441921-43441943 AACAAGGCCCAGGGAGGTGAAGG + Intronic
906144748 1:43553250-43553272 CTAGAGGCCCAGAGAGGTTAAGG - Intronic
906251420 1:44313685-44313707 ATCAAGGCTCAGAGAAGGGGTGG - Intronic
906274232 1:44504415-44504437 GTCAAGGCTCAGAAGGGTCAGGG - Intronic
906520636 1:46464982-46465004 ATCAAGGCTCAGAGACACCAAGG - Intergenic
906648245 1:47491603-47491625 CTGAAGGCTCAGACAGGTTCAGG + Intergenic
906711740 1:47935267-47935289 ACAAAAGCTCAGAGAGGTTAAGG + Intronic
906733846 1:48105592-48105614 ACCAAGGCAAAGAGATGTTAAGG + Intergenic
906843299 1:49162739-49162761 ACCAAAACTCAGAAAGGTTAAGG - Intronic
907113000 1:51943777-51943799 ATGAAGGCTGAGAGAGGTGAAGG + Intronic
907350061 1:53821663-53821685 ACAAAGGTTCAGAGAGGCTAGGG + Intronic
907481237 1:54746826-54746848 ACCAAGGCCCAGAGAGGGCAGGG - Intergenic
907497013 1:54851952-54851974 ACCCGGGCTCAGAGGGGTTAAGG + Exonic
907524318 1:55045345-55045367 AATGAGGCTCAGAGAGGTGAAGG - Intronic
907644987 1:56233276-56233298 ACCAATGCACAGAGAGATTAGGG - Intergenic
908100996 1:60790915-60790937 TCCAAGTCTCAGAGAGTTTAGGG - Intergenic
908558299 1:65279979-65280001 ACTGAGGCTCAGAGAAGTTAAGG - Intronic
908869825 1:68596699-68596721 ATGAAGGCTGAGAGAAGTTAAGG + Intergenic
909124969 1:71656315-71656337 ACCAAGGCTCAGAAATGTTAAGG - Intronic
909979552 1:82082475-82082497 ATGCAGGCTCATTGAGGTTATGG + Intergenic
909997840 1:82302827-82302849 ATCAAGCCTCAGTGAAGCTAGGG - Intergenic
910059479 1:83071439-83071461 ACAAAGGCTTAGAGAGGTTAAGG + Intergenic
910198649 1:84674123-84674145 GGTATGGCTCAGAGAGGTTAAGG - Intronic
910298330 1:85675910-85675932 ATGAAGGCTGAGAGAGGTGAGGG - Intronic
910367626 1:86483690-86483712 ATTCAGGTGCAGAGAGGTTAAGG + Intronic
910647516 1:89529778-89529800 TTCAAGGCTGAGGAAGGTTAAGG - Intronic
910766140 1:90784280-90784302 ATAGAGGCTCAGAAAAGTTAAGG + Intergenic
911583397 1:99661542-99661564 ATTGAGGCACAGAGAAGTTAAGG + Intronic
912312177 1:108633852-108633874 ATCAAAGCTCAGAGGGGCTAGGG - Intronic
912516311 1:110218677-110218699 CTTAAGGCTTGGAGAGGTTAAGG + Intronic
912577889 1:110692082-110692104 CTGAAGGCTCAGAGAGATTTAGG - Intergenic
912799362 1:112711567-112711589 ATTGATGCACAGAGAGGTTAAGG + Intronic
913162359 1:116155717-116155739 ATTAAGGCTCAGAGAGATTCAGG - Intergenic
913204355 1:116522924-116522946 ATGGAGGCACTGAGAGGTTAAGG - Intronic
913494726 1:119417904-119417926 ACTGAGGCTCAGAGAGGTTAAGG - Intronic
913500638 1:119469644-119469666 ACTGGGGCTCAGAGAGGTTAAGG - Intergenic
913505141 1:119509986-119510008 ACTGAGTCTCAGAGAGGTTAAGG - Intronic
913511460 1:119566435-119566457 ACTGAGGATCAGAGAGGTTAAGG - Intergenic
913515697 1:119603772-119603794 ACTGAGGTTCAGAGAGGTTAAGG - Intergenic
913572073 1:120130697-120130719 ATTAAAGCTCAGAGAGTTTAAGG - Intergenic
914292997 1:146292333-146292355 ATTAAAGCTCAGAGAGTTTAAGG - Intergenic
914554041 1:148743116-148743138 ATTAAAGCTCAGAGAGTTTAAGG - Intergenic
914887325 1:151596036-151596058 ACCGAGACTCAGAGAGGTGAAGG - Intergenic
915552942 1:156645796-156645818 ATAAAGGCTCAGAGAAGGTAAGG + Intronic
915728435 1:158035624-158035646 GTTAAGGCTCAGAGAAGTGAAGG + Intronic
915836709 1:159182494-159182516 ACCAAGGCTCAGAGAGGTTTAGG - Intronic
916209224 1:162345729-162345751 ACTAAAGCACAGAGAGGTTATGG - Intronic
916240147 1:162631594-162631616 ATCCAGGCTCTGAAGGGTTAAGG + Intronic
916368047 1:164056138-164056160 ATTAAGGCTCAGAGAGGCTAAGG - Intergenic
916469636 1:165110347-165110369 ATCAAAGCACAGAGAAATTAAGG + Intergenic
916576501 1:166071704-166071726 ATGAAGGCTTAAAGATGTTAAGG + Intronic
916988215 1:170214299-170214321 GTCAGGGCTCAGGGAGGTTTGGG + Intergenic
917166080 1:172114730-172114752 ATTGAGGCTCCGAGAGGTTAAGG + Intronic
917176299 1:172239440-172239462 TTCATGCCTCAGAGAGGGTATGG - Intronic
917717071 1:177749030-177749052 ATTCAGTCTCAGAGAGGTCAAGG + Intergenic
917728561 1:177851214-177851236 ATAAAGGAACAGAGATGTTAAGG + Intergenic
918066107 1:181102956-181102978 ATCAAGGCTAAGAGTCCTTAAGG - Intergenic
919810541 1:201406442-201406464 ACTGAGGCACAGAGAGGTTAGGG - Exonic
919960677 1:202465153-202465175 ATTGAGGCTCAGCTAGGTTAAGG + Intronic
920213147 1:204343421-204343443 ACCAAGGCTCAGAGAGGTTAAGG + Intronic
920309786 1:205042266-205042288 AGCGAGGCTCAGAGAGGGCAGGG + Intergenic
920390260 1:205595648-205595670 ATTGAGGCTCAGAGAGGGGAAGG - Intronic
920785863 1:209040463-209040485 ATCAAAGCTCAGAGTGGTGAAGG - Intergenic
920840601 1:209550675-209550697 ACCAAGGCCCAGAGAGGGGAAGG - Intergenic
921134064 1:212244578-212244600 ATGAAGGCACAGAGAGCTGAAGG + Intergenic
921165158 1:212501893-212501915 ACCAAGGCCCAGAGAGGAGAAGG + Intergenic
921260152 1:213379088-213379110 AGCAGGGCTCAGAAAGGTCAAGG - Intergenic
921324135 1:213973813-213973835 ACTAAGGCTCAGAGAGGTACAGG + Intergenic
921330921 1:214034801-214034823 ACTGAGGCTCAGAGAGGGTAAGG - Intronic
921835277 1:219772135-219772157 ATCTCGGCTCAAAGATGTTAAGG - Intronic
921877655 1:220217059-220217081 ATGGAGTCTCGGAGAGGTTAAGG + Intronic
922154796 1:223032363-223032385 ACTGAGGCCCAGAGAGGTTAAGG - Intergenic
922180590 1:223230020-223230042 ATCAAGGCTCAAAGAGGTTAAGG - Intronic
922516485 1:226211984-226212006 ACCGATGCTCAGAGAGGTTAAGG + Intergenic
922747541 1:228053157-228053179 ATCAAGGTGCTGACAGGTTAGGG - Intronic
923023847 1:230188699-230188721 AGCAAGGGTCACAGAGTTTATGG - Intronic
923559600 1:235028488-235028510 AACCAGGCTCAGAGAGGGGAAGG + Intergenic
924009812 1:239652752-239652774 AATAAGGCTCAAAGAGGTTAAGG - Intronic
924013822 1:239697538-239697560 ATCAAGGCTCATAGATGGCAAGG + Intronic
924335189 1:242980512-242980534 ATCAAGGCACTGAGAGGTTATGG - Intergenic
924578165 1:245299636-245299658 ACGGAGGCTCAGAGAAGTTAGGG + Intronic
1062848990 10:728877-728899 ATGACAGCACAGAGAGGTTAGGG - Intergenic
1062895035 10:1096854-1096876 GTGAAGGCTCAGAGAGGAAAGGG + Intronic
1063998616 10:11643883-11643905 TTCAAGCCTCAGAGAGATCAAGG - Intergenic
1064251836 10:13711796-13711818 AACAAGGCCCAGAGAAATTAAGG + Intronic
1064454336 10:15472879-15472901 AGCAACGCTCAAAGAGATTAGGG - Intergenic
1064520517 10:16196101-16196123 AGAAAGGCTCAGAAAGGTGAGGG + Intergenic
1064704422 10:18057047-18057069 ACTGAGGCTCAGAGAGGTTGAGG - Intergenic
1065313472 10:24438992-24439014 AGCATGGCTCAGAGAGGATATGG - Intronic
1065573487 10:27096108-27096130 ATCAAGCCTGAGAGAAGTTCTGG - Intronic
1065934200 10:30506105-30506127 ATCAAAGCACAGAGAGGGTAAGG - Intergenic
1066524671 10:36263535-36263557 ATTAAGGCACAGGCAGGTTAGGG + Intergenic
1067235108 10:44440212-44440234 ATCGAGGCTCAGAGAAGTAGAGG - Intergenic
1067294317 10:44966166-44966188 ATTAAGGCCCAGAGAGGAGAAGG + Intronic
1067707441 10:48620372-48620394 AAGCAGGCTCAGAGATGTTAAGG + Intronic
1067793431 10:49304338-49304360 ATTGAAGGTCAGAGAGGTTAAGG - Intronic
1067994314 10:51253593-51253615 AGCAAGTCTCAGAGAAGTCAGGG + Intronic
1068602854 10:58974010-58974032 ACTAAGGTTTAGAGAGGTTAAGG - Intergenic
1068632734 10:59314404-59314426 ATCAAAGCCCAGAGAGGTTAGGG + Intronic
1068662931 10:59641956-59641978 GCCAAGGCTGAGAGAGGTTGTGG - Intergenic
1068663212 10:59646060-59646082 GCCAAGGCTGAGAGAGGTTGTGG + Intergenic
1069107741 10:64404583-64404605 AATAAGGCTCAGAGAAGTTAAGG + Intergenic
1069750634 10:70743087-70743109 ATTGAGGACCAGAGAGGTTAAGG - Intronic
1069858975 10:71458430-71458452 AACGAGGTTCAGAGAGGTTAAGG - Intronic
1069861348 10:71473585-71473607 ATTGAGGCTCAGAGAGGTTGAGG - Intronic
1069923808 10:71834168-71834190 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1070542217 10:77424370-77424392 ATGAAGGCTCAGAGAGGTCAAGG + Intronic
1070625277 10:78046710-78046732 ATTGAGGCTCAAAGAGGTTAAGG + Intronic
1070745134 10:78929122-78929144 ACCAAGGCTCAGGGAGGTCGAGG - Intergenic
1071439096 10:85674591-85674613 CTGGAGGCTCTGAGAGGTTAAGG + Intronic
1071512194 10:86269078-86269100 ACCAAGGTTCACAGAGGTGAAGG - Intronic
1071574211 10:86714178-86714200 ATTGAGGCCCAGAGAGGTTAAGG + Intronic
1071747696 10:88440582-88440604 ATCAAGGATTATAGAGGTAAGGG - Intronic
1071801341 10:89065234-89065256 ATACAGGCTCAGGAAGGTTACGG - Intergenic
1072031208 10:91524355-91524377 ATCGAGGCTCAGAGATATTGAGG - Intergenic
1072211419 10:93250030-93250052 ATTGAGGCTCAGGGAGGTTAAGG + Intergenic
1072452562 10:95550380-95550402 ACCAAGGCCCAGATAGGTTAAGG + Intronic
1072640520 10:97207734-97207756 ACCACGGCTCAGAAAGGTTAGGG - Intronic
1072748270 10:97957522-97957544 ACCAAGGCTCAGCAAGGTTAGGG + Intronic
1074155037 10:110790876-110790898 CTGAAGCCTCAGAGAAGTTAAGG - Intronic
1074298555 10:112212724-112212746 ACCAAGGCTAAGAGAGCATAAGG - Intronic
1074363180 10:112838844-112838866 AGTGAGGCTCAGGGAGGTTAAGG - Intergenic
1074519914 10:114209919-114209941 ATCAAGACTTAGAGACATTATGG - Intronic
1074974413 10:118568480-118568502 ATCAAGGCTCACATAGTTTGGGG + Intergenic
1075236763 10:120737455-120737477 ACTGAGGCTGAGAGAGGTTAAGG - Intergenic
1075263567 10:120982366-120982388 ATTAAGGTTGGGAGAGGTTAAGG - Intergenic
1075387124 10:122062946-122062968 ATCAGGGCTCAGAGAGGTTAAGG + Intronic
1075414467 10:122252283-122252305 ATGGAGGCTCAGAGAAGTTAAGG - Intronic
1076201115 10:128559136-128559158 ATCAAACCTGAGAGAGGATAAGG - Intergenic
1076425279 10:130363165-130363187 AGTAAGGCTCAGCGAGGCTAAGG - Intergenic
1076430604 10:130399308-130399330 ATCAAGCCTCAGAGAGGGACAGG + Intergenic
1077130125 11:967691-967713 AGTTGGGCTCAGAGAGGTTAAGG + Intronic
1077560428 11:3257038-3257060 ACTAAGGCTCAGAGAGATTGAGG + Intergenic
1077566325 11:3302855-3302877 ACTAAGGCTCAGAGAGATTGAGG + Intergenic
1078305951 11:10186571-10186593 AACAGGGCTCAGAGAGCTTTTGG - Intronic
1078338732 11:10484139-10484161 AGATAGGCTCAGAGAGGTAAAGG + Intronic
1078440114 11:11357675-11357697 ACTGAGGCTCAGAGAAGTTAAGG - Intronic
1078611247 11:12821348-12821370 ATGAAGACTCAGAAAGGTTTTGG - Intronic
1078753701 11:14188754-14188776 AGACAGGCTCAGAGAGATTAAGG - Intronic
1078852723 11:15179127-15179149 AACGAGGCTGAGAGAGGTTCAGG - Intronic
1078959731 11:16250308-16250330 ATCAAGGCTAAAAGAGCTTCTGG + Intronic
1079096260 11:17512318-17512340 AATCAGGCCCAGAGAGGTTAAGG - Intronic
1079123647 11:17702982-17703004 ATGGAGGCTCAGAGAGATTGAGG + Intergenic
1079154294 11:17930132-17930154 ACTAAGGCTCAGAGAGATTATGG - Intronic
1079306962 11:19331906-19331928 ACTAAGGCCCAGAGAGGTTAAGG + Intergenic
1079806996 11:24944315-24944337 ACCATGGCTCTGAGAGGTTAAGG + Intronic
1080397232 11:31901473-31901495 ATAAAGGCTCAGAGAGGTGAAGG - Intronic
1081582203 11:44360065-44360087 ACTGAGGCTCAGAAAGGTTAAGG + Intergenic
1081607858 11:44538399-44538421 ACCAAGGCTCAGAGAGGAAATGG + Intergenic
1081655165 11:44852364-44852386 ATTGAGGCCCAGAGAAGTTAAGG + Intronic
1081702996 11:45163675-45163697 ACCAAGGCCCAGAGAGGGAAAGG - Intronic
1081763004 11:45590352-45590374 GCAATGGCTCAGAGAGGTTATGG + Intergenic
1081864712 11:46353198-46353220 ACCAAGGCTCAGAAAGGTCAGGG + Intronic
1081869196 11:46375674-46375696 ATCAAGGCCCAGAGAGGGCAGGG - Intronic
1082988469 11:59187284-59187306 ATTGAGGCACAGAGAGGTTAAGG - Intronic
1083039296 11:59670125-59670147 ACTAAGGCTCAGAGAGGTTTAGG - Intergenic
1083678253 11:64339977-64339999 AACAAGGCCCAGAGAGGTGAAGG + Intergenic
1083826560 11:65207136-65207158 ATTCAGGTTCACAGAGGTTAGGG + Intronic
1083892067 11:65600432-65600454 TTCCAGGCTCAGAGAGGTTGAGG + Intronic
1084010495 11:66345835-66345857 ACCGAGGCTCAGAGAGGTAACGG + Exonic
1084137755 11:67199606-67199628 GTAAAGGCTGAGAGAGGTGAGGG + Intronic
1084272085 11:68034348-68034370 AACAAGGTTCCGAGAGGTTGAGG - Intronic
1084527591 11:69706338-69706360 AGCAATGCTCTGAGAGCTTAGGG + Intergenic
1084532002 11:69732844-69732866 ACTGAGGCTCAGAGAGGTGAGGG + Intergenic
1085041693 11:73330698-73330720 ATCTAGGCCCAGAGAGGGGATGG - Intronic
1085198334 11:74685533-74685555 ATGGAAGCTCAGAGAGGTTAAGG - Intergenic
1085245454 11:75097369-75097391 ATGAAGACCCAGTGAGGTTAAGG - Intergenic
1085255111 11:75168229-75168251 ACCAAGGCCCAGAGTGGGTAAGG + Intronic
1085260284 11:75200583-75200605 ATTGAGGCTCAGAGAAGTTCAGG + Intronic
1085455375 11:76662451-76662473 ATCTAGGCTCAGGGAGGGGAAGG + Intronic
1085690783 11:78662164-78662186 ATGAAGGCACAGGGAGGTTGTGG - Intronic
1085692164 11:78672755-78672777 ACCAAAGCTCAGGGAGGTGAAGG + Intronic
1085719523 11:78900685-78900707 ATCAAGGTTCAGGGATGTTAGGG + Intronic
1085764757 11:79273125-79273147 ACTAAGGCTCTGAGAGGTAAAGG - Intronic
1085958418 11:81429452-81429474 ACCAAGGCTCAGAGTGGTTGTGG - Intergenic
1086189463 11:84061187-84061209 AATAAGGCTTAGAGAGGCTAAGG - Intronic
1086316461 11:85599551-85599573 ACTGAAGCTCAGAGAGGTTAAGG - Intronic
1086338312 11:85822129-85822151 ACTAAGGATCAGAGAGGTGAAGG + Intergenic
1086458376 11:86981704-86981726 ACTAAGGCACAGAAAGGTTAAGG - Intergenic
1087131748 11:94674651-94674673 ATTGAAACTCAGAGAGGTTAAGG - Intergenic
1087605842 11:100376935-100376957 AACAAGCCTCAGAGAGGTTGGGG + Intergenic
1087687146 11:101277723-101277745 CTTGAGGCACAGAGAGGTTAAGG + Intergenic
1087816556 11:102664822-102664844 ACTAAGGCACGGAGAGGTTAAGG + Intergenic
1088533453 11:110835612-110835634 ATTGAGGTTCAAAGAGGTTAGGG - Intergenic
1088596538 11:111445197-111445219 ACTGAGGCTCAGAGAGGTTTGGG - Intronic
1088698717 11:112392585-112392607 GTTAAGGCCCAGGGAGGTTAAGG - Intergenic
1088740627 11:112764029-112764051 ACTAAGGCTCAGGGAAGTTAGGG + Intergenic
1089100784 11:115960763-115960785 GCAAAAGCTCAGAGAGGTTAAGG + Intergenic
1089582147 11:119488222-119488244 ATCAAAGCTCAGGGAGGCCATGG - Intergenic
1089782302 11:120882215-120882237 ATTAAGGCTCAGACAGGTTGAGG + Intronic
1090027439 11:123179842-123179864 ACAGAGGCTCAGAGAAGTTAGGG - Intronic
1090416824 11:126546286-126546308 ATGGAGGCCCAGTGAGGTTATGG + Intronic
1090452419 11:126818438-126818460 AAATAGGCTCAGAGAGGTTACGG - Intronic
1090621313 11:128563483-128563505 GCAAAGGTTCAGAGAGGTTAAGG - Intronic
1090845061 11:130523408-130523430 ACCAAGGCTCAGAGAAGTTTAGG - Intergenic
1091078874 11:132647242-132647264 ACTAAGGCTCAGAGAAGCTAAGG - Intronic
1091110783 11:132964453-132964475 ACTAAGGCTCACACAGGTTATGG - Intronic
1091343198 11:134835804-134835826 AAGAATGCTCAGAGAGGTGAAGG + Intergenic
1091384458 12:83974-83996 ACTGAGGCTCAAAGAGGTTAAGG + Intronic
1091389228 12:115690-115712 AAATGGGCTCAGAGAGGTTAAGG + Intronic
1091633897 12:2182947-2182969 ACAGAGGCTCAGAAAGGTTAAGG - Intronic
1091768355 12:3136483-3136505 ATTGAGGCTCAGAGAAGTGAAGG + Intronic
1091769545 12:3142095-3142117 ACCAAGGCACAGAGAGGTTAAGG + Intronic
1091787784 12:3253406-3253428 AACGAGGCCCAGAGAGGTCAAGG - Intronic
1091818339 12:3456000-3456022 ACGCAGGCTCAGAGAAGTTAAGG - Intronic
1091853814 12:3722930-3722952 ACTGAGGCTCAGAGAGGGTAAGG - Intronic
1091971778 12:4793585-4793607 AATGAGACTCAGAGAGGTTAAGG + Intronic
1092477922 12:8834932-8834954 ATCTGGGCACAGAGAAGTTAGGG - Intronic
1092725732 12:11483917-11483939 ACTGAGGCTCAGAGAGGTTAAGG + Intronic
1092737490 12:11596442-11596464 ATCAAGGCCCAAAGATGTTATGG + Intergenic
1092911312 12:13147126-13147148 ACTAAGGCTCAAAGAGGTTAAGG - Intergenic
1092953365 12:13527907-13527929 ATAAGGGCTCAGAGAAGTTGAGG - Intergenic
1092986991 12:13855307-13855329 ACTAAGGCTCAGAGAAGTGAAGG + Intronic
1093669817 12:21860360-21860382 ATCAAGGCTGAGAGAGGTTAAGG - Intronic
1093709432 12:22313131-22313153 ACTAAGGCTTAGAGAGGCTATGG - Intronic
1094008689 12:25783694-25783716 ATAAAGGCATAGGGAGGTTATGG + Intergenic
1094047998 12:26188135-26188157 GCCAAGGCTTAGAGAGGTTAAGG + Intronic
1094571212 12:31643024-31643046 ACCGAAGCACAGAGAGGTTACGG + Intergenic
1094587968 12:31795362-31795384 ATTGAGGCTCAAGGAGGTTAGGG - Intergenic
1094754276 12:33448328-33448350 ATGAAGGCTGAGAGAGGTGAGGG - Intergenic
1095284720 12:40395277-40395299 CTGAAGGCTGAGAGAGGTAAGGG - Intronic
1095929534 12:47611849-47611871 ATCAAGGTGCTGACAGGTTAGGG + Intergenic
1095951881 12:47786062-47786084 CTCAAGGCTCAGGGAGGTTAAGG + Intronic
1096153063 12:49326502-49326524 ACCAAAGCTCAGAGAGGTGAAGG - Intronic
1096315766 12:50563830-50563852 ATGAAGGATCAAAGAAGTTAAGG - Intronic
1096574987 12:52547181-52547203 ACTGAGGCTCAGAGAGGATAAGG - Intronic
1096590749 12:52657679-52657701 ATCAAGGCTCAGAAAAGCTGAGG - Intergenic
1096636710 12:52965057-52965079 ATGAAGGAGCTGAGAGGTTAAGG + Intergenic
1097730643 12:63124156-63124178 ATCGAGGTTCAGAGAGATTCCGG - Intergenic
1098062359 12:66576602-66576624 ATTAAGGCTCACAGAGGCTTAGG - Intronic
1098861493 12:75715914-75715936 ACAGAGGCTAAGAGAGGTTAAGG + Intergenic
1098950502 12:76636082-76636104 AGCAAGGTTCAGAGATATTAAGG + Intergenic
1098989821 12:77053014-77053036 TTCAAGTGTCAGAGAGGATATGG + Intronic
1099162035 12:79253921-79253943 ATGAAAGCTGAGAGAGGTAAGGG + Intronic
1099228981 12:80001421-80001443 ACCTAAGCCCAGAGAGGTTAAGG + Intergenic
1099287527 12:80733053-80733075 ACCAAGGCTCAGATAAATTAGGG + Intergenic
1099787091 12:87279306-87279328 ACCAAGGCTCTGGGAGATTAAGG + Intergenic
1100069253 12:90691236-90691258 ATGAAGGCAGAGAGAGGTGAGGG + Intergenic
1100119706 12:91354855-91354877 AAGTAGGCTCAAAGAGGTTAAGG - Intergenic
1100298734 12:93287297-93287319 ATCAAGGTTCAGAAAGATCAAGG + Intergenic
1100382102 12:94071611-94071633 ATTGAGGCCCAGAGAGGCTAAGG - Intergenic
1100605083 12:96145540-96145562 ATTAGGGCACAGAGAGGTTAAGG + Intergenic
1101249058 12:102914423-102914445 ATTAAGGCTTAGAGAGGTTAAGG + Intronic
1101283576 12:103285395-103285417 ATTAGGGCTTAGAGAGATTAAGG + Intronic
1101437178 12:104673783-104673805 TGCCAGACTCAGAGAGGTTAAGG - Intronic
1101582001 12:106049905-106049927 ATCAGGGCTCAGTGAGGCCATGG - Intergenic
1101645938 12:106631007-106631029 ACTAAGGCTCAGAGAAGTGAAGG - Intronic
1101723351 12:107369968-107369990 ACGGAGGCTCAGAGAGGTTGAGG - Intronic
1101896031 12:108757576-108757598 ACTAAGGCTCAGAGAGGTCCAGG + Intergenic
1101943605 12:109119245-109119267 AGCAAGGGTCAGAGTGGCTAAGG - Intronic
1101990270 12:109478117-109478139 ACTGAGGCTCAGAGAGGTGAGGG - Intronic
1102077465 12:110071276-110071298 ACCAAGGCTCAAAGAGGTGAAGG + Intronic
1102167185 12:110815874-110815896 GTTAAGGCACAGAGCGGTTAGGG - Intergenic
1102205572 12:111088644-111088666 GAAAAGGCTCAGAGAGCTTAAGG + Intronic
1102207867 12:111102757-111102779 ACAGAGGCTCAGAGAGGTTAAGG - Intronic
1102359373 12:112270768-112270790 ACCAAGAGTCAGAGAAGTTAAGG + Intronic
1102383636 12:112488192-112488214 ATTAAGGGTCAGAGAGGTTAAGG + Intronic
1102416264 12:112765562-112765584 ATCAAGGCTCAGAAATGCTAAGG - Intronic
1102419954 12:112795618-112795640 ACTGAGGCTCAGAGAGATTAAGG - Intronic
1102565370 12:113794148-113794170 AGGAAGGTTCAGGGAGGTTAGGG - Intergenic
1102629811 12:114268128-114268150 ATTAAAGCTCAGAGAGGGGAAGG + Intergenic
1102636602 12:114329975-114329997 ACCAAGGCTCAGAGAGGGGAAGG - Intergenic
1102693808 12:114782409-114782431 AACAGGGGTCAGAGAGGTCAAGG - Intergenic
1102708012 12:114899353-114899375 ATTAAGGCTCAGAGAAATTAAGG + Intergenic
1102748948 12:115275311-115275333 ACTGAGGCTCAGAGTGGTTAAGG - Intergenic
1102869372 12:116401667-116401689 ACTCAGGCCCAGAGAGGTTAAGG + Intergenic
1103042512 12:117707531-117707553 ACCAAGGCTCAGAGAGGCCAAGG - Intronic
1103206271 12:119131440-119131462 ATCAAGGCTCAGAGAGGTTAAGG + Intronic
1103366609 12:120388904-120388926 ACTGAGGCTCAGAGAGGTTAGGG - Intergenic
1103394812 12:120599369-120599391 ACCAAGGCTCAGAGAGCCCAAGG - Intergenic
1103436403 12:120930193-120930215 ACTGAGGCTCAGAGAGGTTAAGG + Intergenic
1103465048 12:121135494-121135516 ACCAAGGCTCAAAGAGGTGAAGG - Intronic
1103515992 12:121508728-121508750 AAGTAGGCTCAGAGAGGGTACGG - Intronic
1104020307 12:124987932-124987954 ACGAAGGCACAGAGATGTTAGGG + Intronic
1104299033 12:127547149-127547171 ATAGAGGCTCAGAGAGGTTCAGG - Intergenic
1104349099 12:128029468-128029490 GCTAAGGCTCAGAGAGGGTAAGG + Intergenic
1104799576 12:131544634-131544656 ATGAAGGTTGAGAGAGGTGAAGG + Intergenic
1104939476 12:132388136-132388158 ATGCAGGCTCAGAGAGGGGAGGG + Intergenic
1105303612 13:19154890-19154912 ACCAAGGTTCAGAGAGGTCAGGG + Intergenic
1105998544 13:25696640-25696662 GTGAAGGCTGAGAGAGGTGAGGG - Intronic
1106687110 13:32072026-32072048 ATGCAGATTCAGAGAGGTTAAGG - Intronic
1106837675 13:33652722-33652744 ACCAAAGCTCAAAGAAGTTAGGG - Intergenic
1106839882 13:33675544-33675566 ATCAAGGATGAGAAAGGATATGG + Intergenic
1107535572 13:41326602-41326624 ACTGAGGCTTAGAGAGGTTAAGG + Intronic
1108186968 13:47897672-47897694 ATCAAAGATCAGACAGGATAAGG - Intergenic
1108426980 13:50312494-50312516 ACTGAGACTCAGAGAGGTTAAGG - Intronic
1108511091 13:51156436-51156458 ATTAAGGCACAGAGAGGTCAAGG + Intergenic
1109521199 13:63512296-63512318 AGCCAGGCTCAGAGGGGTGAGGG - Intergenic
1110145829 13:72189134-72189156 CTCTAGGTTCATAGAGGTTATGG + Intergenic
1110153597 13:72285577-72285599 ACCAAGGCTCAGCGAGTTTATGG + Intergenic
1110283378 13:73721172-73721194 ACTGAGGCACAGAGAGGTTAAGG + Intronic
1110367295 13:74701331-74701353 CTCATAGGTCAGAGAGGTTAAGG + Intergenic
1111146282 13:84185098-84185120 ATGGAGGCTGAGAGAGGTGAGGG - Intergenic
1113387003 13:109858036-109858058 TTCGAGGATCAGAGAGTTTAAGG - Intergenic
1113512402 13:110866666-110866688 ATGAAGGCACAGAGAGGTTTAGG + Intergenic
1113591282 13:111503072-111503094 AACAAGGCTGTGAGAGGTTAAGG - Intergenic
1113773206 13:112925466-112925488 CTTAAGGCTCCTAGAGGTTAGGG - Intronic
1113961138 13:114126824-114126846 ACCAAGGCAGAGAGAGGTTAGGG + Intronic
1113980949 13:114275244-114275266 ATGAAGGCTGAGAGAGGCGAGGG - Intergenic
1114335598 14:21686230-21686252 ACTATGGCTCAGAGAAGTTAGGG - Intergenic
1114501202 14:23170158-23170180 ACTGAGGCTCAGAGAGGTGAAGG + Intronic
1114535307 14:23418682-23418704 AAACAGGCTCAGAAAGGTTAGGG + Intronic
1115368827 14:32589203-32589225 ATCAAGGCTGAGGGAGGTGGGGG - Intronic
1116091705 14:40315982-40316004 GTGAAGGCTAAGAGAGGTGAGGG + Intergenic
1116758694 14:48982891-48982913 ACCAAGGCCCAGGTAGGTTAAGG + Intergenic
1117107887 14:52417545-52417567 ACTAAGGCTCAGAGAGGTAAAGG - Intergenic
1117173705 14:53127364-53127386 GCTGAGGCTCAGAGAGGTTAAGG - Intronic
1117492973 14:56270784-56270806 TTGAAAGATCAGAGAGGTTATGG + Intronic
1117737974 14:58786861-58786883 ACAAAGGCACAGAAAGGTTAAGG + Intergenic
1118266634 14:64301067-64301089 ATTAAGACTCAGAGAATTTAAGG + Intronic
1118445007 14:65842834-65842856 ATGGAGGCTCAGTGTGGTTAAGG + Intergenic
1118612328 14:67551489-67551511 ACTGAGGCACAGAGAGGTTAAGG + Intronic
1118720276 14:68589032-68589054 ACTGAGGCTTAGAGAGGTTAAGG - Intronic
1118727632 14:68640330-68640352 ACCAAGGCTCCCAGAGATTAAGG - Intronic
1119416695 14:74475362-74475384 ATTAAGGCCCTAAGAGGTTAAGG + Intergenic
1119540039 14:75431984-75432006 AGAGAGGCACAGAGAGGTTAGGG + Intronic
1119646998 14:76355200-76355222 AGTAGGGCTCAGAGAAGTTAAGG + Intronic
1119688953 14:76655489-76655511 ATTAAGGCACAGAGAGGTTAAGG + Intergenic
1119704388 14:76774883-76774905 TCCCAGGCTCAGAGATGTTAAGG - Intronic
1119724216 14:76912366-76912388 ACTGAGGCACAGAGAGGTTATGG + Intergenic
1119806946 14:77488290-77488312 ATGGAGGCTCAGGGAGGGTAGGG + Intronic
1119892473 14:78193270-78193292 ACTGAGGCTCAGAGAGGTTTAGG + Intergenic
1119962889 14:78880346-78880368 TTCAAGCCTAAGAGAGGTAATGG - Intronic
1119992495 14:79214995-79215017 CTCAAGGTCCAGAAAGGTTAGGG + Intronic
1120228739 14:81819985-81820007 ATCAAGGCTCTGGCAGGTTTGGG + Intergenic
1120664955 14:87294914-87294936 AGCAAGGCTCAAAGAGGTGAGGG - Intergenic
1120718022 14:87860981-87861003 CTCGAGACACAGAGAGGTTAAGG - Intronic
1121270927 14:92637915-92637937 ACAGAGGCTCAGGGAGGTTAAGG - Intronic
1121418897 14:93798519-93798541 ACTGAGTCTCAGAGAGGTTAAGG - Intergenic
1121439593 14:93940341-93940363 GTCAAGACTCTGAGAGATTAAGG + Intronic
1121496148 14:94392389-94392411 ACCAAGGCTCAGAGAACTGAGGG - Intergenic
1121659159 14:95621930-95621952 ATGGAGGCACAGAGAAGTTAAGG - Intergenic
1121662147 14:95643161-95643183 AGCGAGGCTCAGAGAGGTTGAGG + Intergenic
1121712802 14:96052060-96052082 ACCGAGGCTCAGAGAGCTTTGGG + Intronic
1121735584 14:96215885-96215907 ACTGAGACTCAGAGAGGTTAAGG + Intronic
1121959345 14:98244525-98244547 TTCCCGGCACAGAGAGGTTAAGG - Intergenic
1122052370 14:99068570-99068592 GCAGAGGCTCAGAGAGGTTAAGG - Intergenic
1122078641 14:99251940-99251962 ACTGGGGCTCAGAGAGGTTAAGG - Intronic
1122087021 14:99314844-99314866 GCCAAGGCTCAGAGAGGCTTAGG + Intergenic
1122136755 14:99637849-99637871 ACCAATGCCCAGAGAGGTCAAGG + Intergenic
1122138526 14:99648351-99648373 ACATAGGCACAGAGAGGTTAAGG + Intronic
1122295655 14:100704317-100704339 CAAAAGGCTCAGAGGGGTTAAGG - Intergenic
1122414763 14:101543606-101543628 ATTGAGGCCCAGAGAGGGTAGGG - Intergenic
1122425190 14:101601679-101601701 CAGAAGGCTCAGAGAGGTGAGGG - Intergenic
1122662541 14:103307379-103307401 GTGAAGGCTGAGAGAGGTGAGGG - Intergenic
1122985764 14:105210922-105210944 AGCCAGGGTCAGAGAGGCTAGGG - Intronic
1124425289 15:29558026-29558048 AATGAGGCTCAGAGAGGTTAAGG + Intronic
1124594607 15:31082412-31082434 ATCACAGCTCAGAGGGGTTGGGG - Intronic
1125402237 15:39316559-39316581 ATCAAAGCTCAGTGAATTTAAGG + Intergenic
1125926962 15:43570990-43571012 ATTGAGGCTTAGAGAAGTTAAGG + Intronic
1125940106 15:43670555-43670577 ATTGAGGCTTAGAGAAGTTAAGG + Intergenic
1126123897 15:45278296-45278318 GCCAAGGCACAGAGAAGTTAAGG - Intergenic
1126139928 15:45429415-45429437 ATTAAGACTCAGAGAGGCTCTGG - Intergenic
1126926389 15:53592205-53592227 ATCAAGGAGCAGAGAAGTAATGG - Intronic
1127658563 15:61078590-61078612 ACCAATGCTCAGAGAGGATAAGG + Intronic
1127708673 15:61573537-61573559 CTCAAGACTCAAATAGGTTAAGG + Intergenic
1127710986 15:61598053-61598075 ATTGAGGCTCAGGGAGGTCAAGG + Intergenic
1127813569 15:62586013-62586035 ACTGAGGCACAGAGAGGTTAAGG + Intronic
1127917140 15:63464127-63464149 GTGGAGGTTCAGAGAGGTTAGGG - Intergenic
1128259674 15:66224176-66224198 ACCAAGGCTCAGAGAGGTGAAGG - Intronic
1128474987 15:67989547-67989569 ATCAAGGCTGAGAAAGATTAAGG + Intergenic
1128536839 15:68498031-68498053 ACTGAGGCTCAGAGAGGTTAAGG + Intergenic
1128658371 15:69479153-69479175 ATCGAGGCCCAGAGAGGGCAAGG - Intergenic
1128867102 15:71122314-71122336 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
1129110399 15:73333842-73333864 ACCAAGGCTCAGAGAAGTACAGG + Intronic
1129517885 15:76167905-76167927 AGAAAGGGTCAGAGAAGTTAAGG - Intronic
1129602590 15:77009027-77009049 ACCAAGGCTCAGAGAGTTGAGGG - Intronic
1129696675 15:77744213-77744235 ACTGAGGGTCAGAGAGGTTAGGG - Intronic
1129704122 15:77784870-77784892 AGGGAGGCTCAGAGAGGTCAAGG - Intronic
1129713381 15:77832950-77832972 AAACAGGCTCAGAGAGGTCAAGG + Intergenic
1129788371 15:78323911-78323933 ACTAAAGCTCAGAGAGGTTGAGG - Intergenic
1129850113 15:78788936-78788958 AGGAAGGCTCAGAGAGTCTAAGG + Intronic
1130252153 15:82306640-82306662 AGGAAGGCTCAGAGAGTCTAAGG - Intergenic
1130655859 15:85791830-85791852 AACAAAGCTCAATGAGGTTAAGG + Intronic
1130691208 15:86082946-86082968 ATGGAGGCTCAGAGAGGTCGAGG - Intergenic
1131171803 15:90184517-90184539 CTCCAGGCTCAGAGAGGTTAAGG + Intronic
1131317964 15:91357254-91357276 ACGGAGGCTCAAAGAGGTTAGGG - Intergenic
1131804261 15:96105333-96105355 AAGAAGGCTCAGAGAAGTTCAGG - Intergenic
1131972152 15:97903756-97903778 AATAAGGTTCAGAGAGGTTAAGG - Intergenic
1131995472 15:98128699-98128721 ATGGAAGCTCAGAGAGGTTGAGG - Intergenic
1133257172 16:4524133-4524155 ACTGAGGCTCAGAGAGGTTGAGG - Intronic
1133267134 16:4591987-4592009 ACCAAGGCTCAGAGAGGGAAGGG + Intronic
1133335230 16:5002746-5002768 ATGGAGGCACAGAGAGGTTCAGG + Intronic
1133503686 16:6389744-6389766 ATCATGGGCCAGAGAGGTTCAGG + Intronic
1133730859 16:8577462-8577484 ATGAGGGCTCACAGAGGTGAAGG - Intronic
1133896097 16:9930329-9930351 ATGGAGGCTCAAAGAAGTTAAGG + Intronic
1134087837 16:11370867-11370889 ACAAAGGCTCAGAGAGTTGAGGG - Intronic
1134211855 16:12284280-12284302 CTTGAGGCTTAGAGAGGTTAGGG - Intronic
1134375481 16:13668682-13668704 ATAGAGGCTTAGAGAGGTTAAGG - Intergenic
1134385965 16:13772761-13772783 ATCAAGGCTCAGGAAGGGTGAGG - Intergenic
1134506229 16:14809519-14809541 AGTGAGGCTCAGAGAGGTTAAGG - Intronic
1134574323 16:15319245-15319267 AGTGAGGCTCAGAGAGGTTAAGG + Intergenic
1134640861 16:15828156-15828178 AGTGAGACTCAGAGAGGTTAAGG - Intronic
1134728094 16:16437053-16437075 AGTGAGGCTCAGAGAGGTTAAGG - Intergenic
1134756736 16:16673876-16673898 ATTAAGCCACAGAGAGGGTAAGG - Intergenic
1134939342 16:18274773-18274795 AGTGAGGCTCAGAGAGGTTAAGG + Intergenic
1134989332 16:18685287-18685309 ATTAAGCCACAGAGAGGGTAAGG + Intergenic
1135113553 16:19708437-19708459 ACCAAGGCTTAGAGAGGTTAGGG - Intronic
1135116883 16:19731311-19731333 AGCAAGGCTCTGAGAGATGAAGG + Intronic
1135126760 16:19816932-19816954 ATTGAGGCTCAGGGAGTTTAAGG + Intronic
1135191844 16:20360778-20360800 CTGGAGGCTAAGAGAGGTTAGGG - Intronic
1136019011 16:27428232-27428254 TACAAGGCTCAGAGAGGGCAAGG + Intronic
1136055351 16:27684229-27684251 ATGGAGGCACAGAGAGGTTAAGG + Intronic
1136102401 16:28005655-28005677 ACTGAGGCACAGAGAGGTTAAGG - Intronic
1136179321 16:28539917-28539939 ACCAAGGCACAGAGAGGTGAAGG - Intergenic
1136300409 16:29330238-29330260 CTCAAGGCACAGACAGGTTGGGG + Intergenic
1136526354 16:30833932-30833954 ATTGAGTCTCTGAGAGGTTAAGG - Exonic
1136538554 16:30914850-30914872 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1137554875 16:49464257-49464279 ACCAAGGCACAGGGAGGTCAGGG - Intergenic
1137558107 16:49485467-49485489 ACTGAGGCTCAGAGAAGTTAAGG + Intergenic
1137575800 16:49599450-49599472 ACCAAGACTCAGAGAGGTTAAGG + Intronic
1137589141 16:49682744-49682766 ACTGAGGCTCAGAGAGGCTAGGG - Intronic
1137611848 16:49823430-49823452 ACTGAGGCTCAGAGAGGATAAGG + Intronic
1137750712 16:50859354-50859376 ATTGAGGCTCAGAGATGTTAAGG - Intergenic
1137935053 16:52626991-52627013 ATTGAGGCTCAGAATGGTTAAGG + Intergenic
1138066957 16:53952164-53952186 ACTAAGACCCAGAGAGGTTAGGG + Intronic
1138206018 16:55125626-55125648 AATGAGGCTCAGAGAGGTAAAGG - Intergenic
1138211149 16:55164340-55164362 ACCATGGTTCTGAGAGGTTAGGG + Intergenic
1138211314 16:55165452-55165474 ATGAAGGCACAGAGGTGTTAAGG - Intergenic
1138231406 16:55339527-55339549 ACTGAGGCTCAGAGAGATTAGGG - Intergenic
1138297079 16:55896208-55896230 AACAAGTCTCAGAGAGCTGATGG - Intronic
1138601113 16:58055124-58055146 CCCAAGGCTCAGAGAGGTGAAGG + Intergenic
1139348572 16:66320956-66320978 ACTAAGGTTCAGAGAGGTTAAGG + Intergenic
1140510826 16:75507002-75507024 ATCATGGGTGAGGGAGGTTAGGG + Intergenic
1140516681 16:75548094-75548116 ATCAAGGATGAGTGAGATTAGGG + Intronic
1140841136 16:78840267-78840289 ATCAAGGCACAGAGAGGTTCAGG - Intronic
1140985986 16:80158372-80158394 AATGAGGCTCAGAGAGGTGAGGG - Intergenic
1141045358 16:80711621-80711643 AGGAAGGCTCAGAGAGGTAGAGG - Intronic
1141142543 16:81506157-81506179 ACCAAGGCTCGGAGAGGTTAAGG + Intronic
1141152905 16:81576802-81576824 ACCAAGGCTTAGAGAGGTACTGG - Intronic
1141223676 16:82094884-82094906 ATGGAGGCTCAGAGAAGTTAAGG + Intronic
1141560335 16:84863592-84863614 AAGAAGGCTCAGAGAGGGTAAGG - Intronic
1141717634 16:85735951-85735973 ATCAGGGCTCAGAGAGGTGGCGG + Intronic
1141929833 16:87194977-87194999 AAACAGACTCAGAGAGGTTAAGG + Intronic
1141982373 16:87558551-87558573 AACAAGGGCCAGAAAGGTTAGGG - Intergenic
1141999196 16:87654520-87654542 ACCGAGGCTCTGAGAGGTGAAGG - Intronic
1142126969 16:88415088-88415110 ACCGAGGCTCAGAGAGGGGAAGG - Intergenic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142715678 17:1745673-1745695 ATCAGGGGTCAGGGAGGTCAAGG - Intronic
1143091893 17:4453832-4453854 AGCAAGGCCCAGATTGGTTATGG + Intronic
1143202002 17:5119850-5119872 ACTGAAGCTCAGAGAGGTTAAGG + Intronic
1143284052 17:5776028-5776050 ATTGAGGCTCAGAGAGGTTAAGG + Intronic
1143698728 17:8641016-8641038 ATGGAAGCTCAGAGAGGTTAAGG - Intergenic
1143852202 17:9821546-9821568 ACTGAGGCTCAGAGAGGTGAAGG + Intronic
1144576515 17:16433139-16433161 ACCAAGGCTCAGAGGAGATAAGG - Intronic
1144627420 17:16851307-16851329 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1144760345 17:17703588-17703610 ACTGAGGCTCATAGAGGTTAAGG + Intronic
1144794294 17:17880693-17880715 ACGAAGGCTCAGAGAGGCTCAGG - Intronic
1144847896 17:18229583-18229605 AGCAAGGCTCACAGAGGTGCAGG - Intronic
1144879020 17:18421412-18421434 ACTGAGGCTCAGAGAGGTTAAGG + Intergenic
1145153217 17:20522982-20523004 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1145294557 17:21578081-21578103 CTCCAGACTCAGAGAGGTGATGG - Intergenic
1146307337 17:31740553-31740575 ATGAAAGCTCAGAGAAGTCAAGG + Intergenic
1146316425 17:31810765-31810787 ATTGAGGCTGAGAGAGGGTAAGG - Intergenic
1146503285 17:33382683-33382705 ATTGAGGATCAGAGAGGCTAAGG + Intronic
1146503813 17:33387270-33387292 ATTGAGGCTCAGAAAGATTAAGG + Intronic
1146687063 17:34848361-34848383 ATCAAGGCTCAGGCAGGTTAAGG - Intergenic
1146927431 17:36754612-36754634 GACGAGGCTCGGAGAGGTTAGGG + Intergenic
1147038244 17:37697947-37697969 ATGAAGGCTCAGGGAGGTCAAGG + Intronic
1147541874 17:41367063-41367085 ATCAAGCCTCAGAGAGATAAAGG - Intronic
1147547744 17:41416027-41416049 AACAAAGCTCAGAGCAGTTAGGG + Intergenic
1147581551 17:41629982-41630004 ACGGAGGCTCAGAGAGGTTAAGG - Intergenic
1147598380 17:41731339-41731361 ACAAAGGTTCAGAGAGGTCAAGG + Intronic
1147603963 17:41763509-41763531 AATGAGGCTCAGAGAGGTTGGGG + Intronic
1147653831 17:42077401-42077423 ATTGAGGCTCAGAGAGGTGAAGG + Intergenic
1147904616 17:43814613-43814635 ATTGAGGCTCAGAGAGATGAAGG - Intronic
1147950871 17:44107256-44107278 GAGAAGGCTCAGAGAGGTTAAGG - Intronic
1148017802 17:44534668-44534690 GTTAAGGCACAGAGTGGTTATGG + Intergenic
1148025902 17:44587457-44587479 ATCCAGGCTGAGAGAGGCCATGG + Intergenic
1148069719 17:44901267-44901289 ATTGAGACTCAGAGAAGTTAAGG - Intronic
1148167703 17:45494873-45494895 ACTGAGGCTCAGAGAGGTTTTGG - Intergenic
1148630839 17:49107342-49107364 ACTAAAGCACAGAGAGGTTAAGG + Intergenic
1148736197 17:49866333-49866355 ACCAAGGCTCAGAGAAGTTAAGG + Intergenic
1148861422 17:50606249-50606271 ACAGAGGCTCAGAGAGGGTAAGG + Intronic
1149033591 17:52110390-52110412 ATTGAGGCTCAGAGAGGTTAAGG - Intronic
1149297731 17:55275664-55275686 ATCAAGGTTCAGAAAGATTAAGG - Intronic
1149442921 17:56690338-56690360 ACTGAGGCTCTGAGAGGTTAAGG - Intergenic
1149533570 17:57415105-57415127 ATCTAGGCTCATAGATGTTATGG + Intronic
1149866572 17:60154377-60154399 ACTGAGGCTCAGAGAGCTTAAGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150398882 17:64841288-64841310 ACTGAGGCTCAGAGAGGTTTTGG - Intergenic
1150606559 17:66696388-66696410 AACAAAGGTCAGAGAGTTTAAGG - Intronic
1150625713 17:66839897-66839919 AGCAAGGCCCAGAAGGGTTAAGG + Intronic
1151222290 17:72622208-72622230 ACCAAGTCCCAGAGAAGTTAAGG + Intergenic
1151326733 17:73384256-73384278 ACTGAGGCTCAGAGATGTTAAGG + Intronic
1151352845 17:73541930-73541952 AGGCAGGCTCAGAGAGGTTTGGG - Intronic
1151964458 17:77424220-77424242 ACCGAGGCACAGAGAGGTTGAGG + Intronic
1152106210 17:78330639-78330661 ACTAAGGCTCAGAGAGGTTCAGG + Intergenic
1152267751 17:79306206-79306228 AGCAGGGCTCAGGGAGGTCACGG - Intronic
1153017643 18:597772-597794 ATCAATGCTCATACAGTTTATGG + Intronic
1153153998 18:2128362-2128384 ATTGGGTCTCAGAGAGGTTATGG - Intergenic
1154197153 18:12274993-12275015 AGCAAGGCTCAGAGAAGTTAAGG - Intronic
1155266578 18:24100399-24100421 AGCAAGGCTTAAAGAGGTGAAGG - Intronic
1155487121 18:26357150-26357172 AGTAAGGCTCTAAGAGGTTAGGG - Intronic
1155576066 18:27248333-27248355 TTCAAGGAGCAGAGAGTTTAGGG - Intergenic
1156159095 18:34338138-34338160 ATTGTGGCACAGAGAGGTTAAGG - Intergenic
1156234042 18:35183794-35183816 ACAAAGGATCAGAGAGGTTAAGG - Intergenic
1156270332 18:35524638-35524660 GCCGAGGGTCAGAGAGGTTAAGG - Intergenic
1156530544 18:37810781-37810803 ATCAGGGCTGAGAGAGCTTGGGG - Intergenic
1156967815 18:43116877-43116899 ATTGAGGCACAGAGAGGTGAAGG - Intergenic
1157194847 18:45612631-45612653 ACCAAGACACAGAGAGGTTGTGG + Intronic
1157243668 18:46034749-46034771 ATTGAGGTTCAGAGAGGCTATGG - Intronic
1157290534 18:46406551-46406573 ACCAAGGCTCAGAGAGGTCCTGG + Intronic
1158159855 18:54468829-54468851 ACAGAAGCTCAGAGAGGTTATGG - Intergenic
1158201583 18:54947531-54947553 ACCGAGGCACAGAGAAGTTAAGG - Intronic
1158351630 18:56570306-56570328 ACCAAGGCTTAGAGAAGTTAAGG - Intergenic
1158687379 18:59626831-59626853 ATCAAGGCCTGGAGGGGTTAAGG + Intronic
1160167412 18:76526702-76526724 TTGAAGGCTCAGAGAGATTTAGG - Intergenic
1161119989 19:2520451-2520473 ATGGAGGCTCAGAGAGGTTAAGG + Intronic
1161254767 19:3301758-3301780 ATTAAAGCCCAGAAAGGTTAAGG + Intergenic
1161262138 19:3343969-3343991 ATAAAGGCTCAGAGAGGGGCAGG + Intergenic
1161277225 19:3425284-3425306 ACTGAGGCTCGGAGAGGTTAAGG + Intronic
1161279682 19:3439061-3439083 ATTGAGGGGCAGAGAGGTTAAGG - Intronic
1161452862 19:4356204-4356226 ACCAAGGCTCTGAGAGGGGAGGG - Intronic
1161526733 19:4760515-4760537 TCGAGGGCTCAGAGAGGTTAAGG - Intergenic
1161606668 19:5218898-5218920 ACCAAAGCTCACAGAGGTTAAGG - Intronic
1162056981 19:8070681-8070703 ACTGAGGCTCTGAGAGGTTAGGG - Intronic
1162938670 19:13995133-13995155 GCTGAGGCTCAGAGAGGTTAAGG + Intronic
1162966528 19:14158832-14158854 ATGAAGGCTCAGAGAGGTCAGGG - Intronic
1163012778 19:14435450-14435472 ACCGAGGCTCAGAGAGGCGAAGG - Intronic
1163450883 19:17376851-17376873 ACTCAGGCTCAGAGAGGTGAGGG + Intronic
1163577426 19:18118836-18118858 ACCCAAGCACAGAGAGGTTAAGG - Intronic
1163597185 19:18226931-18226953 ATCCAGGCTCTGAGATCTTAGGG - Intronic
1163773712 19:19205841-19205863 ACTGAGGCTCAGAGAGGTCAAGG - Intergenic
1163969712 19:20780454-20780476 ATTAAAATTCAGAGAGGTTATGG + Intronic
1164583394 19:29449369-29449391 ATTGAGTCTCAGAAAGGTTAAGG + Intergenic
1164724834 19:30459023-30459045 ACCAAGGCACAGAGAGGCTGAGG - Intronic
1164764507 19:30753732-30753754 ATAAAGGCTGAGAGAAGTAAAGG - Intergenic
1165043915 19:33089252-33089274 ACCAAGGGTCAGAGAGGTTAAGG + Intronic
1165388617 19:35526115-35526137 ACAAAGGCTCAGAGAGGTTAGGG - Intronic
1165921968 19:39304895-39304917 ACTGAAGCTCAGAGAGGTTAAGG - Intergenic
1166520720 19:43478498-43478520 ACCAAGACTCAGAGAAGTTAAGG + Intronic
1166725167 19:45022436-45022458 ACTGAGGCTCAGAGAGGGTAAGG + Intronic
1166841818 19:45702015-45702037 ATCAAAGCACAAAGAGGTTAAGG - Intronic
1166950267 19:46422549-46422571 GCCAAGGCTCAGAGAGGTGAAGG - Intergenic
1167112131 19:47468727-47468749 ACCAAGGCGCAGAGAGGTTACGG + Intronic
1167612246 19:50513166-50513188 ACCAAGGCCCAGAGAGGGTCAGG + Intronic
1167682032 19:50929556-50929578 ACCATGGCTCAGAGAGGTCAAGG + Intergenic
1167744639 19:51343322-51343344 ACTTAGGCTCAGAGAGGTCAAGG + Intergenic
925188552 2:1865455-1865477 ACTAAGGCTCAGAAAGGTTCAGG - Intronic
925355403 2:3237743-3237765 ACCAAGGCTCAGAGAGATGCAGG - Intronic
925896062 2:8473189-8473211 ATTGAGGCTCACAGAGGTTAAGG - Intergenic
925916954 2:8613838-8613860 ACCAAGGCACAGAGATGTCAAGG - Intergenic
926105318 2:10146162-10146184 CTTGAGGCTCAGGGAGGTTAAGG + Intronic
926150437 2:10422877-10422899 AACAAGGCTCGGAGAGGTCAGGG - Intronic
926167011 2:10527431-10527453 ACCTAGGCTCAGAGAGGCTGAGG - Intergenic
926168327 2:10535342-10535364 ATGGAAGGTCAGAGAGGTTAGGG - Intergenic
926193831 2:10748760-10748782 ATTAAGACTCAGAGAGCTAAAGG - Intronic
926281961 2:11456492-11456514 ATAAAGGCCCAGAGAGGCTGAGG - Intronic
926972788 2:18483773-18483795 ACCAAGGCCCAGAGAGGGGAAGG - Intergenic
927014348 2:18942013-18942035 ATGAAGACTGAGAGAGGTGAGGG - Intergenic
928021749 2:27710804-27710826 ACTAAGACTCAGAAAGGTTAAGG + Intronic
928088196 2:28358749-28358771 CCCAAGTCTCAGAGAGGTTTGGG - Intergenic
928093672 2:28391645-28391667 ACTGAGGCCCAGAGAGGTTAAGG + Intergenic
928118618 2:28565745-28565767 AGAGAAGCTCAGAGAGGTTAGGG - Intronic
928267867 2:29827266-29827288 ATCAAGGTCCAGAGAGACTAAGG + Intronic
928401734 2:30983972-30983994 ACCCGGGCTCAGAGAGGTTAGGG - Intronic
928636079 2:33248328-33248350 ATTAAGGCATAGAGGGGTTAGGG + Intronic
929071879 2:38039236-38039258 ACTATGGCTCAGAGAGGATAAGG + Intronic
929315018 2:40466543-40466565 AGCAAGGCTCAGAGCAGTTGTGG - Intronic
929726591 2:44435991-44436013 ACAAAGGCTCTGTGAGGTTAAGG + Intronic
929790227 2:45017012-45017034 CTCAAGGCTCAGAGGGCTCAGGG - Intergenic
929998807 2:46847245-46847267 ATCACGGCTCACAGAGGTGAGGG + Intronic
930322112 2:49868665-49868687 ATGAAGGCTGAGAGAGGCAAGGG - Intergenic
930715765 2:54592882-54592904 CCCAAGGCTCAGTGAGGTTAAGG - Intronic
930888247 2:56352866-56352888 TATAAGGCTTAGAGAGGTTAAGG - Intronic
931467447 2:62503485-62503507 ATCCAGGGTCACAGAGGTTTGGG - Intronic
931745912 2:65291992-65292014 ATCTAGGCACAGAGAGGATAAGG - Intergenic
931769103 2:65482181-65482203 ACCAAGGCCCAGAAAGCTTAAGG + Intergenic
931862877 2:66375094-66375116 ACCAAGGAGCAAAGAGGTTAAGG - Intergenic
932340621 2:70960805-70960827 ATCCAAGCCCAGAGAGGTGAGGG - Intronic
932691798 2:73919790-73919812 ATTGAGGCTCAGAGAAGTCAAGG + Exonic
933244914 2:79964316-79964338 ACCAAGGCTAATAGAGTTTAAGG + Intronic
933325828 2:80835793-80835815 AAGAAGGCCCAGAGAGGTTCAGG - Intergenic
933386999 2:81623553-81623575 ATGAGGGCTGAGAGAGGTGAAGG - Intergenic
934102933 2:88670146-88670168 ATGGATACTCAGAGAGGTTAAGG + Intergenic
935204338 2:100884576-100884598 ATCAAGGCTGAGAAAGATTGTGG + Intronic
936249339 2:110855352-110855374 ACTAATGCTCAGAGAGGTTGAGG + Intronic
936505281 2:113100624-113100646 ACTGAGGCTCGGAGAGGTTAAGG + Intergenic
937601930 2:123747697-123747719 AACAAAGCTCAGAGAAGTAAAGG + Intergenic
937750799 2:125474480-125474502 ACCAAATCTCAGAGAGGTTAAGG - Intergenic
937835258 2:126465046-126465068 ATCAAGGCATGGAGACGTTAAGG - Intergenic
937950776 2:127386911-127386933 CTTGAGGCTCAGAGAGATTAAGG - Intronic
938292338 2:130156828-130156850 ATCAAGGTTCAGAGAGGTTAGGG + Intronic
938464213 2:131516139-131516161 ACCAAGGTTCAGAGAGGCTAGGG - Intergenic
938701848 2:133886531-133886553 AGCCAGGCTAAGAGAGATTACGG + Intergenic
939401032 2:141694144-141694166 ACCAAGGCTTAGAGAGGTAGAGG - Intronic
939497442 2:142941036-142941058 AGTAAGACTCAGAGAGGTTCTGG - Intronic
939663703 2:144922916-144922938 ATGAAGGCTGAGAGAGGTGAAGG + Intergenic
940504488 2:154535495-154535517 ATCATGGCAAAGACAGGTTATGG - Intergenic
940651511 2:156445233-156445255 AAAAAGGCACAGAGAAGTTAAGG + Intronic
940991867 2:160105600-160105622 ACTAAGGCTCAGAGAAGTTAAGG - Intronic
941680546 2:168393955-168393977 TTCAGGGGTCAGAGAGCTTAAGG - Intergenic
941737340 2:168993355-168993377 AACTAGGCTCAGAAAGGTAAGGG - Intronic
941785921 2:169498512-169498534 ATTGAGGCTTAGAAAGGTTAAGG + Intronic
941902434 2:170691361-170691383 AGCTAGGTGCAGAGAGGTTATGG + Intergenic
942232014 2:173869091-173869113 ACCAAGGCTCAGAGGAGTGAAGG - Intergenic
942616614 2:177797364-177797386 ATTGAGGCTCAGAAAGGTTTAGG - Intronic
942844903 2:180412472-180412494 ATCGAGCCACAGAGAGGTGAAGG - Intergenic
943013208 2:182477442-182477464 ATTGAGGCTCAGAAAGGTCAAGG + Intronic
944283017 2:197919959-197919981 ATCAAAGCACAAAGAGGTTAGGG - Intronic
944469220 2:200035244-200035266 AACAAGGCTCAGAAAGCTTTAGG + Intergenic
944497352 2:200321319-200321341 ATTAAGGTTTAGAGAGTTTAAGG - Intronic
945013968 2:205494832-205494854 ACTGAGGCTCAGAGACGTTAAGG - Intronic
945639351 2:212403934-212403956 AGCAAGTATCAGAGAAGTTATGG - Intronic
945833647 2:214813133-214813155 ACTAATGCTCAGAGAGCTTAAGG - Intergenic
945979799 2:216300141-216300163 GTTAAAGCTCAGAGAGGCTAAGG - Intronic
946105189 2:217363065-217363087 GCTGAGGCTCAGAGAGGTTAAGG + Intronic
946247132 2:218394297-218394319 ACAGAGGCTGAGAGAGGTTAAGG + Intronic
946334231 2:219026959-219026981 ATCAGGACTCAGAGACATTAAGG + Intronic
946418168 2:219550953-219550975 ACCAAGGCCCAGAAAGGGTAGGG - Intronic
946756723 2:222954455-222954477 ATTGAGGCTCAGAGATGTTAAGG + Intergenic
947242652 2:228013143-228013165 TTCTAAGCTCAGAGATGTTATGG - Intronic
947923910 2:233904359-233904381 ATTAAGGCTCAGAGAAATTAAGG - Intergenic
948459723 2:238123394-238123416 ATTGAGGCTCAGAGAGGGCAAGG - Intronic
948486404 2:238284001-238284023 CACAAGGCTCAGGGAGGTTAAGG - Intronic
948917273 2:241040670-241040692 ACCAAGGCCCAGAGAGGGGAAGG - Intronic
1168833588 20:861289-861311 GTCAAGGTGCAGAGAGGTTAAGG + Intergenic
1168834467 20:868912-868934 ATTAGGGCTCAGAGAGGGAAAGG - Intergenic
1168860478 20:1042954-1042976 ACTGAGGCTCAGAGAGGTGAAGG + Intergenic
1168928112 20:1599271-1599293 ATTGAGGCTCAGAGAATTTAGGG + Intronic
1169049808 20:2566175-2566197 TATTAGGCTCAGAGAGGTTAAGG - Intronic
1170157728 20:13284048-13284070 ACTGAGGCTCAGAGAGGTTAAGG - Intronic
1170602005 20:17848468-17848490 ACCAAGGCTCAGAGAGGAGCAGG - Intergenic
1171116357 20:22527905-22527927 AACAATGACCAGAGAGGTTAGGG - Intergenic
1172177850 20:32983444-32983466 ACCAAGGCTCCTAGAGGGTAGGG + Intergenic
1172197825 20:33104236-33104258 ACCAAGGCTTAGAGAAGTTAAGG + Intronic
1172250388 20:33475443-33475465 CTCCAGGCTCAGAGCAGTTAAGG - Intergenic
1172501317 20:35430011-35430033 ACTGAGGCTCAGAGAGCTTAAGG + Intergenic
1172595608 20:36149170-36149192 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
1172701095 20:36854204-36854226 ACTAAGGCCCAGAGAGGTTAAGG - Intronic
1172750139 20:37245053-37245075 ACCAAGGCCCAGAGAGGTAAAGG - Intergenic
1172753438 20:37267364-37267386 ACTGAGGCTCAGAGAGATTAAGG - Intergenic
1172807649 20:37624142-37624164 ACCGAGGCCCAGAGAGGTAAAGG + Intergenic
1172811203 20:37649594-37649616 AAGAAGGCTCAGAGAGGTAGAGG + Intergenic
1172841511 20:37905007-37905029 ACCAAGGCTCAGAGAGGTGAAGG + Intronic
1172845458 20:37927623-37927645 GGCAAGGCTCAGAGAGGGCAGGG - Intronic
1172901841 20:38340868-38340890 ATAGAGGGCCAGAGAGGTTAAGG - Intergenic
1173131554 20:40398665-40398687 ATCGAGCCTCTAAGAGGTTAAGG - Intergenic
1173134292 20:40425692-40425714 ATGAAGGCTCAGAAATGTTAAGG - Intergenic
1173147056 20:40534051-40534073 ATTGAGGCTTAGAGAGGTTAAGG - Intergenic
1173149381 20:40552925-40552947 ATCGAGCCTTAGAGAGGTTCAGG - Intergenic
1173159433 20:40641382-40641404 GTAAAGGCTCAGAGAGGGGAAGG - Intergenic
1173182313 20:40814586-40814608 ACCAAGGCACAGAGAGGTTAAGG - Intergenic
1173350504 20:42241036-42241058 AGTGAGGCTCAGAGAGGTTAAGG + Intronic
1173518715 20:43683374-43683396 AGCAAGGCTCAGAGAGGTTGGGG + Intronic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1173653566 20:44683366-44683388 ATGGAGGCACAGAGAGGTCAAGG + Intergenic
1174178771 20:48661917-48661939 ATCAAGGCTCGGAGAGGTAAAGG + Intronic
1174191579 20:48744369-48744391 ATAGAGGCTCAGAGAGGCAAAGG + Intronic
1174198902 20:48793504-48793526 ACCAAGGTACAGAGAGATTAAGG + Intronic
1174203680 20:48824671-48824693 AATAAGGCTCAAACAGGTTAAGG + Intronic
1174264378 20:49320613-49320635 AGCAAGGCTCAGAGAGGAGAGGG + Intergenic
1174275790 20:49403156-49403178 CAAAAGGCTCAGAGAAGTTAAGG + Intronic
1174288690 20:49491095-49491117 ATTGAGGCTCAGAGAGGTTAGGG - Intergenic
1174326987 20:49787138-49787160 AGCAGGGTTCAGAGAGGTTAAGG + Intergenic
1174404051 20:50292475-50292497 ACCAAGGCCCAGAGAGGGCAAGG - Intergenic
1174458710 20:50667862-50667884 ATGGAAGCTCAGAGAGGCTACGG - Intronic
1174459950 20:50675449-50675471 ATCAAGACTCAGAGAAGTTAAGG + Intronic
1174514019 20:51077309-51077331 AGCAAGGCACAGAGAGGTTAAGG + Intergenic
1174558133 20:51411158-51411180 ATCAAGGCTCAGTGAGGCAAAGG + Intronic
1174874783 20:54215639-54215661 ATAGAGGCTTAGAGAGGTTATGG + Intronic
1174894331 20:54432609-54432631 ACTAAGGCTCAGAGATATTAAGG - Intergenic
1175047607 20:56122090-56122112 GTTAAGGCTCAGAAAGGTTAAGG + Intergenic
1175172172 20:57088421-57088443 ACTAAGCCTCAGAGAGATTAGGG - Intergenic
1175205781 20:57310091-57310113 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1175318082 20:58065823-58065845 ACTGAGGCCCAGAGAGGTTAAGG - Intergenic
1175355942 20:58368159-58368181 AACACAGGTCAGAGAGGTTAAGG - Intergenic
1175488260 20:59361098-59361120 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
1176036216 20:63038360-63038382 AACAAGCCTCAGAGAGGATGTGG - Intergenic
1176638894 21:9278167-9278189 ATCAAGACACAGAGAGTTAAGGG - Intergenic
1178376696 21:32073413-32073435 ACTGAGGCACAGAGAGGTTAAGG - Intergenic
1178752281 21:35316342-35316364 ACCAAGGCTCACAGAAGCTATGG + Intronic
1178766812 21:35461548-35461570 TTCAAGTCTCACAGAGGTTTCGG - Intronic
1179085364 21:38211954-38211976 ACAGAGGCTCAGAGAGGTTAAGG - Intronic
1179437632 21:41373378-41373400 AACAAGGCACAGAGAGGGTGTGG - Intronic
1179473246 21:41626104-41626126 AGCAAGACCCAGAGAGTTTATGG + Intergenic
1180372200 22:12051011-12051033 ATCAAGACACAGAGAGTTAAGGG - Intergenic
1180422938 22:12885673-12885695 ATCAAGACACAGAGAGTTAAGGG - Intergenic
1181759581 22:25048983-25049005 GTTGAGGCTCAGAGAGGTTGAGG + Intronic
1181772500 22:25136311-25136333 ATCAAGGCTCAGAGACAACAAGG + Intronic
1181906547 22:26201694-26201716 ACCAAGGCTCAGAGAAATTAAGG - Intronic
1181921653 22:26325427-26325449 ACCGAGGCTCAGAGAGCTGAAGG + Intronic
1181953870 22:26574176-26574198 ACTGAGGCTCAGAGAAGTTAAGG - Intronic
1181961179 22:26622742-26622764 ATCAAGGCTCAGAGTTGAGAAGG + Intronic
1182015190 22:27033239-27033261 ATAAAGGCCCAGAGAGGAGAAGG + Intergenic
1182048767 22:27297544-27297566 ATCTAGGCTCTGAGAGGCTCAGG + Intergenic
1182049668 22:27303085-27303107 ATTGAGGCTCAGAGAGGTGAAGG + Intergenic
1182281155 22:29218443-29218465 ACTGAGGCTCAGAGAGGTGATGG + Intronic
1182349928 22:29693603-29693625 AAAGAGGCTCAGAGAGGTCAGGG + Intronic
1182374348 22:29835583-29835605 ATCAAAAGTTAGAGAGGTTAGGG - Intronic
1182417591 22:30231407-30231429 ACCAAGGCTCAGAGAGGTGAAGG + Intergenic
1182423898 22:30261980-30262002 ACAAAGGCTCAGAGATGTGAAGG + Intergenic
1182541412 22:31044685-31044707 ACTGAGGCTCAGAGAGGTGAAGG - Intergenic
1182547998 22:31086641-31086663 ACCAAGACACAGAGAGTTTAAGG + Intronic
1182650333 22:31846531-31846553 ACTGAAGCTCAGAGAGGTTAAGG - Intronic
1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG + Intronic
1183081523 22:35459580-35459602 AAAGAGGCTCTGAGAGGTTAAGG + Intergenic
1183101698 22:35588135-35588157 TTAGAGGCACAGAGAGGTTAAGG - Intergenic
1183253629 22:36746780-36746802 ACCAAGGCTCAGCGAGGTGCAGG - Intergenic
1183263194 22:36809564-36809586 ACTGAGGCTCAGAGAGGCTAAGG - Intronic
1183321627 22:37168515-37168537 AAACAGGCTCAGAGAGGTAAAGG - Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183531082 22:38353665-38353687 AAGGAGGCTCAGAGAGGTTAAGG - Intronic
1183547763 22:38464059-38464081 ATTGAGGCTCAGAGACGTGAGGG + Intergenic
1183588318 22:38765977-38765999 AGTGAGGCTCAGAGAGGTTTGGG - Intronic
1183599143 22:38830002-38830024 AAACAGGCTCAGAGAAGTTAAGG - Intronic
1183600741 22:38839008-38839030 ACCAAGGTTCAGAGAGGTTAAGG - Intronic
1183605172 22:38863766-38863788 AGGGAGGCTCAGAGAGGTTGTGG + Exonic
1183653586 22:39172453-39172475 ATGGAGGTTCAGAGAGGTTGAGG - Intergenic
1183716514 22:39536292-39536314 ACCGAGGCACAGAGAGGTTGTGG - Intergenic
1183750662 22:39718504-39718526 ACCAAGGCTCAGAGAGCTTAAGG + Intergenic
1183948948 22:41342128-41342150 GGCAAGACTCAGAGAGGTTAGGG - Intronic
1183956558 22:41383554-41383576 ATTGAGGCTCAGGGAGGTGAGGG + Intronic
1184391345 22:44205260-44205282 ATCAAGGCTCAGAGGAGCCAAGG - Intronic
1184413976 22:44341545-44341567 AAACAGGCCCAGAGAGGTTAGGG + Intergenic
1184445812 22:44546169-44546191 CTCAACGCTCAGAGAAGTGAGGG - Intergenic
1184516301 22:44964920-44964942 GCCAAGGCTCAGAGATGTTAAGG - Intronic
1184535574 22:45084527-45084549 TCTGAGGCTCAGAGAGGTTATGG + Intergenic
1184611851 22:45609105-45609127 ATCATGGCACAGAGAGCTTTGGG + Intergenic
1184658591 22:45954901-45954923 ATTAGAGCTCAGAGAGGCTAGGG + Intronic
1185292096 22:50032288-50032310 AACAGGGCTCAGAGAGGCCATGG + Intronic
949332781 3:2940713-2940735 GTAAAGTCTCAGAGAAGTTAAGG + Intronic
949408786 3:3741768-3741790 ATCAAGGTTTAGAGAAGTTAAGG - Intronic
949708948 3:6852486-6852508 ATCAGAGTTCAGAGAGGTTAAGG - Intronic
949857776 3:8477733-8477755 ACTGAAGCTCAGAGAGGTTAAGG + Intergenic
950045059 3:9944151-9944173 AGTGAGGCTCAGAGAGGTAAAGG - Intronic
950107282 3:10396332-10396354 ACAGAGGCTCAGAGAGGTGAAGG + Intronic
950109369 3:10408666-10408688 ACCAAGGCCCAGAGAGGGGAAGG - Intronic
950128047 3:10522783-10522805 CTGGAGGCTCAGAGAGGTAATGG + Intronic
950158235 3:10739850-10739872 ACTAAGGCTCAGTGAAGTTAAGG + Intergenic
950222627 3:11207648-11207670 ACTAAGGCTCACAGAGGTCAAGG - Intronic
950223327 3:11213358-11213380 ATTGAGGCTCAGAGATGCTAAGG - Intronic
950424566 3:12918124-12918146 ATCAGGGCTCAGAGAAGGAAGGG - Intronic
950431523 3:12953825-12953847 ACCAAGGCTCAGAGAAGTTGGGG - Intronic
950483134 3:13256996-13257018 AACTGGGCACAGAGAGGTTAAGG - Intergenic
950549222 3:13656051-13656073 ACCTAGGCCCAGAGAAGTTAGGG - Intergenic
950633715 3:14300675-14300697 CTTAAGGCTCAGAGAGTTGAAGG + Intergenic
950645766 3:14375652-14375674 ACTGGGGCTCAGAGAGGTTAAGG - Intergenic
950701971 3:14757194-14757216 AAAGAGGCCCAGAGAGGTTAGGG + Intronic
951513187 3:23527735-23527757 AGCAAGGTTCAGAGAGGTTCTGG + Intronic
951615664 3:24540746-24540768 ATTGGGGGTCAGAGAGGTTAAGG + Intergenic
951615842 3:24542842-24542864 GACAAGGCTCAGAGACATTAAGG + Intergenic
952979711 3:38724868-38724890 ATGGCGGCTCAGAGAGGTTTGGG + Intronic
953026652 3:39148984-39149006 TTGGAGGCACAGAGAGGTTAAGG - Intronic
953039084 3:39238875-39238897 AATAAGGCCCAGAGAGGTTAAGG - Intergenic
953549904 3:43894148-43894170 AGTGAGGCACAGAGAGGTTAAGG - Intergenic
953671663 3:44968008-44968030 AGTAAGGCTCAGAGGGGTTGGGG + Intronic
953679023 3:45025912-45025934 ATTGAGGCTCGGTGAGGTTAGGG - Intronic
953690010 3:45109954-45109976 CAGAAGGTTCAGAGAGGTTATGG - Intronic
953972450 3:47357553-47357575 ACAAAGGCACCGAGAGGTTAAGG + Intergenic
954184748 3:48908350-48908372 ACTAAGTCACAGAGAGGTTAAGG + Intergenic
954255935 3:49406207-49406229 ATATAGGCTTTGAGAGGTTAAGG - Intronic
954417918 3:50403121-50403143 ATCAAGGTACAGAGAGGTGAGGG - Intronic
954791927 3:53139636-53139658 ACCAAGGCTCAAAGAGGTCAAGG - Intergenic
955319283 3:57962616-57962638 ATTAAGGCACAGAAAGGTCAAGG - Intergenic
955356512 3:58237130-58237152 ACCGAGGCTCAGGGAGGTGAGGG - Intergenic
955401863 3:58597953-58597975 ACTGAGGCTCAGTGAGGTTAAGG + Intronic
955538605 3:59951121-59951143 AGCAAGGCTTAGGAAGGTTAAGG + Intronic
955706552 3:61733407-61733429 ATCTAGGCACAGAATGGTTAAGG - Intronic
955757985 3:62245591-62245613 ACTAAGGTTCAGAGAGGTGAAGG - Intronic
955784037 3:62517384-62517406 AGTGAGGCTGAGAGAGGTTAAGG - Intronic
956749470 3:72334662-72334684 AGCAGGGCTCAGAGAAGTTAAGG + Intergenic
957415586 3:79898787-79898809 ACCAGGGCTCAGAGAACTTACGG + Intergenic
957927913 3:86839047-86839069 ATCAAGGCTCTGTGAGATTCAGG + Intergenic
958696662 3:97536824-97536846 ATTAAGGCCCAAAGTGGTTATGG - Intronic
959549643 3:107640133-107640155 ATAGAGGCTCAGAGAGGCTTAGG + Intronic
959867080 3:111283267-111283289 ACAGAGGCTCAGAGAGGTAAAGG + Intergenic
960880401 3:122339212-122339234 ATGAAGGCTCAGAGAGGAGGAGG - Intronic
960972311 3:123148753-123148775 ACTTAGGTTCAGAGAGGTTAAGG + Intronic
961375281 3:126461344-126461366 TTTAAGGCTCAGATGGGTTAAGG + Intronic
961381855 3:126500561-126500583 GCAGAGGCTCAGAGAGGTTAAGG + Intronic
961396291 3:126593722-126593744 ATGAAGGCTAAGAAAGGTGAGGG - Intronic
961621427 3:128227761-128227783 AGTAAGACTCAGAGAGGTCAAGG - Intronic
961833573 3:129638411-129638433 ATGGAGGTTCAGAGAAGTTAGGG + Intergenic
962040696 3:131704794-131704816 ATCAAGTCTTAGAGAAATTAAGG + Intronic
962076081 3:132082811-132082833 ATTTAGGCACAGTGAGGTTAAGG + Intronic
962110478 3:132440830-132440852 ACCAAAGCTTAGAGAAGTTAAGG + Intronic
962136412 3:132738988-132739010 AGCAAGGCTCAGAGGAGTAAAGG - Intergenic
962586108 3:136843988-136844010 ATCTAGGCTCAGCTAGGCTAAGG - Intronic
962605025 3:137025850-137025872 ATCAAAGCTCAGAGAGGCCAAGG - Intergenic
962826281 3:139103032-139103054 ATATAGGCTCAGAAAGGTTAAGG - Intronic
962967124 3:140365594-140365616 ACTAAGGCCCAGAGAGGTGAGGG + Intronic
964124005 3:153217161-153217183 ATTAAGGCTTGGAGATGTTAAGG + Intergenic
964418164 3:156471930-156471952 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
964539248 3:157761013-157761035 AGGGAGGCTCAGAGAGGTTTAGG + Intergenic
965727802 3:171737516-171737538 AACAAGGGTCAGAGCGTTTATGG - Exonic
965815754 3:172635031-172635053 TCTGAGGCTCAGAGAGGTTAAGG + Intronic
966586264 3:181629019-181629041 AAACAGGCTCAGAGAGGTGAAGG - Intergenic
966601676 3:181781664-181781686 AAGCAGGCTCCGAGAGGTTAAGG + Intergenic
966984722 3:185168707-185168729 CTGGAGGCACAGAGAGGTTAAGG + Intergenic
967190199 3:186978237-186978259 AAACAGTCTCAGAGAGGTTAAGG + Intronic
967355616 3:188567255-188567277 GTTGAGGCGCAGAGAGGTTAAGG - Intronic
967373908 3:188779975-188779997 ATAAAGGCACAGAGGGCTTAAGG + Intronic
967910902 3:194541791-194541813 AACAGGGCTCAGAGAGTTTCCGG + Intergenic
968283920 3:197497106-197497128 AAAAAGGCTCAGAGAGATAAAGG - Intergenic
1202748001 3_GL000221v1_random:126852-126874 ATCAAGACACAGAGAGTTAAGGG + Intergenic
968539651 4:1158696-1158718 ATGAAGGCTAAGAGAGGTAAGGG - Intergenic
968927625 4:3558141-3558163 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
968941942 4:3643520-3643542 ACCGAGGCTCAGAGAGGTGCAGG + Intergenic
969167313 4:5328080-5328102 ATGAATGCTGAGAGAGGTGAGGG - Intronic
969281740 4:6175209-6175231 CTGAAGGCTCAGAAAGGTTAAGG + Intronic
969326389 4:6446813-6446835 AGGGAGGCTCAGAGAGGATACGG + Intronic
969339675 4:6532264-6532286 GTGAAGGCTCAGAGAGGGTGAGG + Intronic
969350198 4:6593884-6593906 ACCAAGGCCCAGAGAGGTTAAGG + Intronic
969581283 4:8067068-8067090 GTCGAGGCTCAGAGAGGCGAGGG + Intronic
969586825 4:8098704-8098726 AAGGAGGCCCAGAGAGGTTAAGG - Intronic
969620583 4:8276874-8276896 AACAAGGCTTAGAGAGGCCACGG - Intronic
969698286 4:8748257-8748279 ACCAAGGTGCAGAGAGGTTTAGG - Intergenic
969702724 4:8776594-8776616 ACCGAGGCTCTGAGAGGTTGTGG + Intergenic
969721913 4:8896686-8896708 ACAGAGGCCCAGAGAGGTTAGGG + Intergenic
969866695 4:10080944-10080966 ACTAAGGCTCAGAGAGGGTGAGG + Intronic
969922727 4:10556019-10556041 AGCAAGGCTCAGAGAGGTTGAGG - Intronic
970212564 4:13725668-13725690 ACCAAGGCTCATAGAGAATAAGG - Intergenic
970313325 4:14805500-14805522 CTGAAGGCTCAGAGAAATTATGG - Intergenic
970367432 4:15374026-15374048 ATCAAGACTCAGAAACATTAAGG + Intronic
970430560 4:15985365-15985387 ACCGAGGCTCAGAGAGAATAAGG - Intronic
970431271 4:15991029-15991051 TTCAAGGCTCAGAGGGGTTTGGG + Intronic
970455440 4:16219129-16219151 ACCAAGGCCCAGAGAGGCTAAGG + Intronic
970795696 4:19910273-19910295 ATTAAGATTCAGAGAGTTTAAGG + Intergenic
970888456 4:21013942-21013964 GTGAAGGCTCAGAGAAGTAAAGG - Intronic
970964948 4:21917532-21917554 AAAAAGGCTTAGAGAAGTTAAGG + Intronic
971176868 4:24290443-24290465 ATGGAGGCTCAGAGAGGCTAAGG - Intergenic
972247782 4:37263500-37263522 ACCAAGGCTTAAAGAGGTTAAGG - Intronic
972378656 4:38498391-38498413 ATTACCTCTCAGAGAGGTTAAGG + Intergenic
972602819 4:40587666-40587688 ACCAAGGCTCAGGAGGGTTAAGG - Intronic
973872519 4:55180588-55180610 AACAAGACCCAGAGAGGTAAAGG + Intergenic
974167854 4:58227123-58227145 ATAAAGGCTTAGAGAGGTAAGGG + Intergenic
975495325 4:75030293-75030315 GTTAAGGCTCAGAGAGATTAAGG - Intronic
976231261 4:82845873-82845895 ACCAAGGCCCAGAGAAGTGAAGG + Intronic
977623291 4:99162301-99162323 ATCAAGGCACGGTCAGGTTAGGG + Intergenic
977954816 4:103014892-103014914 ATTGAGACTCAGAGAGGTTAAGG - Intronic
978530205 4:109704519-109704541 ATGGAGGCTGAGAGAGGTGAGGG + Intergenic
978947326 4:114515672-114515694 CTCAAGTCTAAGAGAGGTTAGGG - Intergenic
979241924 4:118454768-118454790 ATCAAGGCACTGAGAGGTTATGG + Intergenic
979267566 4:118721051-118721073 ATGAAGGCTCAGAGTGGAGAGGG - Intergenic
979645701 4:123065353-123065375 ACTAAGGCTTAGAGAGGTTAAGG - Intronic
979682783 4:123480106-123480128 ACAAGGGCTCAGAGAGGTGAAGG + Intergenic
979763415 4:124435818-124435840 TCCAAGGCTCAGGGAGGATATGG - Intergenic
981144827 4:141312107-141312129 ATGAATGCTCAGGGAGGTTATGG - Intergenic
982101862 4:151975884-151975906 ACTGAGGCTCAGAGAGGGTAAGG + Intergenic
982211431 4:153039701-153039723 ACAAAGGCTCAGAGAGGTTAAGG + Intergenic
982697074 4:158614571-158614593 ATGAAGGCTGAGAGAGGTGAAGG - Intronic
983338786 4:166430867-166430889 CACAAGTCCCAGAGAGGTTAGGG + Intergenic
983514340 4:168640762-168640784 ATTAAGGCTCAGTGAGGTTAAGG + Intronic
984326221 4:178254889-178254911 ACGAAGGCTTAGAGAGGTGAGGG - Intergenic
1202753783 4_GL000008v2_random:36579-36601 ATCAAGACACAGAGAGTTAAAGG - Intergenic
986647442 5:9931407-9931429 AACATGGCTCACAGATGTTAAGG + Intergenic
986673335 5:10162540-10162562 AACAAGGTTCAGAGAGCTTTAGG + Intergenic
987279866 5:16402072-16402094 CTGAAGGCTGAGAGAGGTGAGGG - Intergenic
987365164 5:17142031-17142053 ATCCAGGCTTGGAGAGGTTCAGG - Intronic
988509976 5:31856484-31856506 ATGCAGGCTCAGAGAGGGTGAGG - Intronic
988857752 5:35245955-35245977 ATCAAGGCCCGGAGAAGTGAAGG + Intergenic
989634274 5:43517571-43517593 ATGAAGGCTGAGAAAGGTGAGGG + Intergenic
990175563 5:53104056-53104078 AAGAAGGCTCAGAGAAGTTAAGG + Intronic
990347791 5:54886255-54886277 ATCAAGGCACAAAGAGGCTAAGG - Intergenic
990458382 5:56010928-56010950 ATCAAAGCTCAGAGACACTAGGG + Intergenic
990490422 5:56297877-56297899 CCTAAAGCTCAGAGAGGTTATGG + Intergenic
990666648 5:58080163-58080185 ACTAAGGCTCAAAGAGATTAAGG + Intergenic
991453401 5:66777082-66777104 ATCGAAGCTCAGAGAGGTCAAGG + Intronic
991465565 5:66908859-66908881 ACTAAGGCACATAGAGGTTAAGG - Intronic
991947602 5:71914768-71914790 ACTGAGGCTGAGAGAGGTTAAGG - Intergenic
992017749 5:72593283-72593305 ACAAAGGCACAGAGAGGTTATGG + Intergenic
992462817 5:76978050-76978072 ATGAAGGCTGAGAGAGGTGAGGG + Intronic
992538209 5:77733578-77733600 ATGAAGGCTAAAAGAGGTAAGGG + Intronic
992632099 5:78691447-78691469 GTCAAGGCTGAGAAAGGTGAAGG + Intronic
994141790 5:96349368-96349390 ATCATGCCACAGAGAGGTCAAGG - Intergenic
995550698 5:113278223-113278245 ATAGAAGCTCAGACAGGTTAAGG - Intronic
995673588 5:114635971-114635993 ACTGAGGATCAGAGAGGTTAAGG + Intergenic
995836460 5:116404677-116404699 ACTAAAGCCCAGAGAGGTTAAGG - Intronic
996526304 5:124483843-124483865 ATGAAGGCTGAGAGAGATGAAGG - Intergenic
997160492 5:131604063-131604085 AACAAGGTTCAGAAAGTTTATGG + Intronic
997362034 5:133301294-133301316 ACCAAGGCCCAAAGAGGTTGGGG - Intronic
997472966 5:134126970-134126992 ACTGAGGCTCAGAGAGGATAAGG + Intronic
997595702 5:135105921-135105943 ACTAAGGCACAGAGAGGTTATGG + Intronic
997598555 5:135123897-135123919 ACCAAGGCCCAGAGAGGTGAAGG + Intronic
998127748 5:139635754-139635776 ATCTGGGCACAGAGAGGTTGGGG + Intergenic
998166832 5:139848867-139848889 ACCGAGGCTCGGAGAGGTTTAGG - Intronic
998395585 5:141815873-141815895 ACTGAGGCTCAGAGATGTTAAGG + Intergenic
998492878 5:142562539-142562561 ATCAAGGCTTACAAGGGTTAAGG - Intergenic
998793208 5:145788410-145788432 ATCTAGGCTGAGAGAGACTATGG + Intronic
998897190 5:146812134-146812156 ACTAAGGTTCAGAGAGGTAATGG - Intronic
998960679 5:147483162-147483184 ATTAAGGCCCAGAAAGGTAAAGG + Intronic
999015835 5:148104225-148104247 AGGAAGGCACAGAGAGGTTAAGG + Intronic
999195063 5:149776280-149776302 ACCAAGGCCCAGAGAGGGAAAGG - Intronic
999249262 5:150172451-150172473 AATGAGGCTCAGAGAGGGTAAGG + Intronic
999676636 5:154010679-154010701 ATCAAAGCTCAGAGTGGGTAGGG - Intronic
1000016187 5:157279231-157279253 ACTGAGGCTCGGAGAGGTTAAGG + Intronic
1000062231 5:157667980-157668002 ACCAAGGCACAGAGAGGTGGAGG + Intronic
1000204496 5:159045938-159045960 AACAAAGCTCAGATAGGCTATGG - Intronic
1000422082 5:161049500-161049522 AATAAGGCTCAGAGAAGATAAGG - Intergenic
1001093388 5:168757920-168757942 ACTAAGGCTCAGAAAGGCTAAGG + Intronic
1001195664 5:169671316-169671338 ATCAAGGCCCAGAGAGGATCAGG + Intronic
1001302104 5:170541123-170541145 ACCAAGGCTCAGAGAGTGGAAGG - Intronic
1001332315 5:170770977-170770999 ATCAAGGCCCAGAGATGCTTGGG + Intronic
1001397446 5:171427523-171427545 GTGGAGACTCAGAGAGGTTAAGG - Intronic
1001428104 5:171638008-171638030 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1001557254 5:172645219-172645241 GTGGAGGCTCAGAGAGGTCAAGG + Intronic
1001594978 5:172892489-172892511 CCCAAGGCTCCGAGAGGTCAAGG - Intronic
1001875906 5:175200225-175200247 ATTAAGGCTGAGAGAGGTGAAGG + Intergenic
1001951484 5:175819786-175819808 GGCCAGGCTCAGAGAGGTGAAGG + Intronic
1001954291 5:175837755-175837777 ACCAAGGCTCAGAGGGGGTGGGG - Intronic
1002322608 5:178384623-178384645 ACCAAGGCTCAGAGGGGGCAGGG + Intronic
1003061542 6:2866620-2866642 ATTAAGCCTGAGGGAGGTTATGG + Intergenic
1003105161 6:3209920-3209942 ACTAAAGCCCAGAGAGGTTAAGG + Intergenic
1003111907 6:3258277-3258299 ACTGAGTCTCAGAGAGGTTAAGG + Intronic
1003320645 6:5048061-5048083 ATTGAGGCTAAGAGAGATTAAGG - Intergenic
1003520705 6:6856297-6856319 ATCAAGGATCAAGGAGGTTGAGG + Intergenic
1004093067 6:12525050-12525072 ATTGAGGCTCAGAGAAGTTAGGG - Intergenic
1004226761 6:13792165-13792187 ACTAAGGCCTAGAGAGGTTAAGG - Intronic
1004572097 6:16856683-16856705 AGCAAGACCCAGAGTGGTTAAGG + Intergenic
1005111901 6:22291370-22291392 ACTGAGGCTCAGAAAGGTTATGG - Intronic
1006082262 6:31574438-31574460 ATAAGGGCTCAGAGAGCTTCAGG + Intergenic
1006153706 6:32002762-32002784 ATCAGGGCTCAGAGAGTCTAAGG - Intergenic
1006160014 6:32035499-32035521 ATCAGGGCTCAGAGAGTCTAAGG - Intergenic
1006246200 6:32738825-32738847 ATTAAAACTCAGAGAGGTAAAGG - Intergenic
1006378279 6:33683767-33683789 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
1006445109 6:34075660-34075682 GATAAGGCTCAGAGAGATTAAGG - Intronic
1006459233 6:34148732-34148754 ACCAATGCTCAGAGAGGCTGGGG - Intronic
1006520730 6:34569528-34569550 TTTGAGGCACAGAGAGGTTAAGG + Intergenic
1006660902 6:35643319-35643341 ATGAAGGCTCAGCAAGATTAAGG - Intronic
1006742740 6:36321032-36321054 ACCGAGACTCAGAGAGGTTAAGG + Intronic
1006813095 6:36833227-36833249 ATTGAGGCTCAGAGAGGTGAAGG - Intronic
1006844352 6:37051989-37052011 AAACAAGCTCAGAGAGGTTAAGG - Intergenic
1007216993 6:40248122-40248144 ACAGAGGCTCAGAGATGTTAAGG - Intergenic
1007221840 6:40284835-40284857 ATTGAGACTCAGAAAGGTTATGG - Intergenic
1007222513 6:40290334-40290356 ATCAAGGCCCAGAGAGAGGATGG + Intergenic
1007807469 6:44461194-44461216 ATCAAAGTTCAGAAAGGTTCTGG + Intergenic
1008319460 6:50090204-50090226 ATGAAGGCTAAGAGAGGAGATGG + Intergenic
1008449026 6:51627940-51627962 ATAAAAGCTCAGTGAGGGTAGGG - Intronic
1008456986 6:51722476-51722498 ACCAATGCTCACAGAGTTTAGGG - Intronic
1008987426 6:57561561-57561583 GTGAAGGCTGAGAGAGGTGAGGG - Intronic
1009175380 6:60454119-60454141 GTGAAGGCTGAGAGAGGTGAGGG - Intergenic
1010063827 6:71656696-71656718 ACCAAGGCTCCAAGAGTTTAAGG + Intergenic
1011104460 6:83764017-83764039 ACCAAGGGTCAGAAAGGATATGG - Intergenic
1011290501 6:85772173-85772195 AATAAGGCTCAGAGGGGTTGGGG + Intergenic
1011829146 6:91349606-91349628 ATGAAGACTGAGAGAGGTGAAGG + Intergenic
1012824737 6:104133039-104133061 ATGAAGGCTGAGAGAGGTGAAGG + Intergenic
1013015913 6:106160477-106160499 ATCTAGGCCCAGAGAGGAAATGG - Intergenic
1013202856 6:107917754-107917776 ACGAAGGCTGAGAGAGGTGAGGG + Intronic
1013605330 6:111742183-111742205 ATCTAACCTCAGAGAGGTTAAGG + Intronic
1014415603 6:121179884-121179906 ACAGAGGCACAGAGAGGTTAAGG + Intronic
1014457052 6:121648017-121648039 ATTGAGGTTCAGAGAGGTTAAGG + Intergenic
1014812488 6:125902357-125902379 TTGGAAGCTCAGAGAGGTTAAGG + Intronic
1015125875 6:129753854-129753876 ATGGAGGCTTAGAGAAGTTAAGG - Intergenic
1015497672 6:133897768-133897790 AACAAGGCTCAGAGTGCTTTTGG - Intergenic
1015944784 6:138488876-138488898 AGCAAGACCCAGAGAAGTTAAGG - Intronic
1016406512 6:143736944-143736966 ATAAAGGCTCAGAGAAGTTGGGG + Intronic
1016749397 6:147616036-147616058 ATTGAGCCTCAGAAAGGTTAAGG - Intronic
1017115346 6:150970938-150970960 TTTAAGGCCCAGAGAGGCTAAGG - Intronic
1018172033 6:161151207-161151229 ATTGGGGCTCAGAGAAGTTAAGG - Intronic
1018435293 6:163753464-163753486 ACCAAGGCTCTGAGAAGTTAAGG - Intergenic
1019486795 7:1293121-1293143 ATCAAGACCCAGAGGGGCTAAGG - Intergenic
1019767154 7:2860095-2860117 AGCGAGGCCCAGTGAGGTTAAGG + Intergenic
1020081345 7:5287553-5287575 ACTGAGGCTCAGAGAGGTTTAGG + Intronic
1020081559 7:5288762-5288784 ACTAAGGCTCAGAGAGGTTTAGG - Intronic
1020112338 7:5454663-5454685 AGTGAGGCTCAGAGAGGTTCAGG + Intronic
1020409145 7:7871450-7871472 ACTGAGGCACAGAGAGGTTAAGG - Intronic
1020802061 7:12744089-12744111 GTAAAGGCTAAGAGAGGTGAGGG + Intergenic
1021349554 7:19573937-19573959 GTAAAGGCTGAGAGAGGTAAGGG + Intergenic
1021425346 7:20493787-20493809 GCCAAGGCTTAGAGAGGTTAAGG + Intergenic
1021470242 7:20994355-20994377 ATCAAAGCTCATAGAAGTCAAGG - Intergenic
1021608800 7:22436062-22436084 AACAAGGCTTAGAGATGTTAAGG - Intronic
1021934067 7:25612911-25612933 ATGAAGGCCAAGAGAGGTGAGGG - Intergenic
1022096121 7:27142719-27142741 AGCAAGGCGCAGAGAGGTAGAGG - Intronic
1022816065 7:33915587-33915609 ATGAAGGCTCAGAGAGGGTAAGG - Intronic
1023487218 7:40699963-40699985 AGGAAGGCTCACAGAGATTAAGG - Intronic
1025197348 7:56943401-56943423 ACTGAGGCTCAGAGAGGTTTAGG + Intergenic
1025197573 7:56944631-56944653 ACTGAGGCTCAGAGAGGTTTAGG - Intergenic
1025674374 7:63632308-63632330 ACTGAGGCTCAGAGAGGTTTAGG + Intergenic
1025674600 7:63633538-63633560 ACTGAGGCTCAGAGAGGTTTAGG - Intergenic
1026836932 7:73645846-73645868 AAACAGGCTCAGAGAGGTCAAGG - Intergenic
1026900592 7:74034776-74034798 AATCAGGCTCAGAGAGGTTAAGG - Intronic
1027221392 7:76216485-76216507 ATCAAGGCTCAGAGAAGGAAGGG - Intronic
1027263056 7:76478714-76478736 ACCAAGGCTGAAAGAGGTCAAGG - Intronic
1027314439 7:76976819-76976841 ACCAAGGCTGAAAGAGGTCAAGG - Intergenic
1027447998 7:78297001-78297023 ACAAAGGCTTAGAGAGATTAAGG - Intronic
1027535983 7:79402505-79402527 ATAGAAGCTCAGAGAGGGTAAGG + Intronic
1028138648 7:87247858-87247880 ATGAAAGCGCAGAGAGGTTAAGG - Intergenic
1029526345 7:101096500-101096522 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1029581910 7:101441941-101441963 AAACAGGCTCAGAGAGGTTTAGG + Intronic
1029608877 7:101616053-101616075 ACCAAGGCCCAGAGAGGGGAAGG + Intronic
1030130634 7:106196582-106196604 GTTGAGGCCCAGAGAGGTTAAGG + Intergenic
1030282871 7:107795213-107795235 GGCAAGGCTCAGAGAGGTTAAGG - Intronic
1030567285 7:111174512-111174534 TTCAAGGTTCAGAGTGGTTACGG + Intronic
1031387512 7:121170303-121170325 ACCAAGGCTCAGAGAGGTACAGG - Intronic
1031690450 7:124781630-124781652 ACCATGGCTCAGAGAGGCCAAGG - Intronic
1031750659 7:125569033-125569055 AACAGGTCTCAGAGAGGGTAAGG + Intergenic
1031927218 7:127650521-127650543 ATCAAGGAGCAAAGAGGTCAGGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032648838 7:133855947-133855969 ATCAAGGCTCAGGATGGTGAGGG - Intronic
1032985946 7:137337381-137337403 ATGCAGGCTTAGAGAAGTTAAGG - Intronic
1034092875 7:148380678-148380700 AACGAGGCTTAGAGAAGTTAAGG - Intronic
1034111060 7:148537834-148537856 CCCAAGGCTCGGAGAAGTTAAGG - Intergenic
1034756334 7:153624232-153624254 AACAAGGGACAGAGAGGTTGAGG + Intergenic
1034980702 7:155474263-155474285 ACCAAGGCCCAGAGAGGAAAAGG - Intronic
1035363558 7:158329727-158329749 ATTAAGGCACAGGGAGGTTAAGG + Intronic
1036618447 8:10406285-10406307 ACACAGGTTCAGAGAGGTTAAGG - Intronic
1036787890 8:11700043-11700065 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1036972786 8:13373746-13373768 ATGAAGATTCAGTGAGGTTATGG - Intronic
1037327791 8:17711472-17711494 ATGAAGGCTGAGAGAGGTGAGGG - Intronic
1037456539 8:19069709-19069731 AGTGAGGCTCAGAGAAGTTAAGG + Intronic
1037667050 8:20978857-20978879 ATCCAGGCTCCGAGGGGATATGG - Intergenic
1037670897 8:21014585-21014607 ATTATGGGTCAGAGAGGCTAAGG - Intergenic
1037885232 8:22592517-22592539 ACTAAAGCCCAGAGAGGTTAAGG - Intronic
1038122195 8:24629730-24629752 AAAAAGGCTCAGATAGATTAAGG + Intergenic
1038424649 8:27456900-27456922 ATGAAGGCTGAGAGAGATTCAGG + Intronic
1039379852 8:37074900-37074922 ATGGAAGCACAGAGAGGTTAAGG - Intergenic
1039833058 8:41233122-41233144 AACCAGGCACTGAGAGGTTAAGG - Intergenic
1040680100 8:49798223-49798245 TTCAAGGATCAGAGATTTTAAGG - Intergenic
1041032386 8:53751016-53751038 ACCAAGGCACAGAGAGGTAAAGG + Intronic
1041452802 8:58025234-58025256 GTCAAAGCTCAGGGAGGTCAAGG + Intronic
1042533428 8:69836146-69836168 AGCAAGGGTCAGAGAGGTGTGGG + Intergenic
1042667337 8:71221361-71221383 ACCAGGCCTCAGAGAGGTGAGGG + Intronic
1043448912 8:80347043-80347065 AAAGAGGCTCAGAGAGGTTAAGG - Intergenic
1043473812 8:80586781-80586803 TTCAAGGGTCAGAGAGTCTAAGG - Intergenic
1043585105 8:81759723-81759745 ACAAAGGCTCAGAGAGTCTAAGG - Intergenic
1043586376 8:81774302-81774324 CTGAAGCCTCAGAGAGATTAAGG - Intergenic
1044247086 8:89961131-89961153 ACCAAGGCTGAGAAAAGTTAAGG - Intronic
1044289173 8:90447383-90447405 ATCTTGGCTCAGAGATGATAAGG - Intergenic
1044462854 8:92466230-92466252 AAGAAGCCTCAGAGAGGGTACGG - Intergenic
1044474642 8:92612083-92612105 AACCAAGCTCAGAGAGGTTCTGG - Intergenic
1044914458 8:97097743-97097765 TTCAAGGCTCTGAGACCTTAGGG - Intronic
1044928646 8:97231054-97231076 ACTGAGGCTCAGAGAGGTTGAGG - Intergenic
1044944314 8:97376467-97376489 ACCAAGTCTCAGAGAGGAAAGGG + Intergenic
1045005124 8:97910784-97910806 CTGAAGGCTCAGAGAAGTTAGGG - Intronic
1045441482 8:102217539-102217561 ACCAAGGTTCAGAGAAGTTAAGG + Intronic
1045507422 8:102788630-102788652 ATCGAAGCTCAGAGAGGTTATGG - Intergenic
1045574196 8:103401336-103401358 ATTAAGTCTCAGAGAGATTAAGG + Intronic
1045686494 8:104718128-104718150 ACAGAGGCTCAGAGAGATTAAGG + Intronic
1045837669 8:106541987-106542009 ATTAAGGCTCAGACATGTTAAGG + Intronic
1046958069 8:120082230-120082252 GCCAAGGCACAGATAGGTTAAGG + Intronic
1047173904 8:122522331-122522353 CTCAAGGCTCAGAGAGAATAAGG + Intergenic
1047217300 8:122886935-122886957 ATGGAGGCTCAGATAGGTTAAGG + Intronic
1047224275 8:122943417-122943439 ACTAAGGCTCAGAGAGGTTAAGG - Intronic
1047303484 8:123634913-123634935 ATTGAAGCTCAGAGAGGTGAAGG + Intergenic
1047616348 8:126565468-126565490 ATGAGGTGTCAGAGAGGTTATGG - Intergenic
1048157870 8:131978506-131978528 ACTGAGGCACAGAGAGGTTAAGG - Intronic
1048195023 8:132325347-132325369 ATCAAGGCTCAGAAATGGAAAGG - Intronic
1048208566 8:132435414-132435436 ACTAAAGCTCAGAGAGCTTAAGG + Intronic
1048291737 8:133186407-133186429 ATCAAGGCACAGAAAGCTAAAGG - Intergenic
1048639070 8:136332666-136332688 AATACAGCTCAGAGAGGTTAAGG - Intergenic
1048690688 8:136959639-136959661 ACTGAGGCTCAGAGAGGTTAAGG + Intergenic
1048708761 8:137184436-137184458 AGTGAAGCTCAGAGAGGTTAAGG - Intergenic
1048722550 8:137342866-137342888 ATCAAAGCCCAGATAGGTTAAGG - Intergenic
1048825057 8:138416295-138416317 TTAAAGGTTCAGGGAGGTTAGGG - Intronic
1048853832 8:138669626-138669648 ACTCAGGCTCAGAGAGGTTTAGG - Intronic
1049082261 8:140452582-140452604 AAATTGGCTCAGAGAGGTTATGG - Intronic
1049235438 8:141510216-141510238 AGCGAGGCTCAGAGAGGACAGGG - Intergenic
1049267006 8:141673414-141673436 ACCGAGGCTCAAAGTGGTTAAGG + Intergenic
1049337241 8:142092931-142092953 AGCCAGGCACAGAGAGGCTAAGG - Intergenic
1049412676 8:142480343-142480365 ACTGAGGCTCAGGGAGGTTAAGG - Intronic
1049428224 8:142546986-142547008 ATCAGGGCTCAGAGTGGCCAAGG + Intergenic
1049546683 8:143235113-143235135 ACCACGGCTCAGAGAGGGCAGGG - Intergenic
1049770117 8:144376034-144376056 CCCAAGGCCCAGAGAGGTTATGG - Intronic
1049969246 9:807242-807264 ACCAAGGCACAGAAGGGTTAAGG + Intergenic
1050289421 9:4138681-4138703 ATAGAGGCACAGAGAGCTTAAGG - Intronic
1050745901 9:8875832-8875854 AGCAGGGCTCAGAGAAGTTAAGG - Intronic
1051077394 9:13256177-13256199 GTGAAGGCTGAGAGAGGTGACGG - Intronic
1051197935 9:14584190-14584212 ACCAAGGCTCAAAGGGGTTATGG - Intergenic
1051499703 9:17763745-17763767 AACAAGGGTCAGAGAATTTAAGG + Intronic
1051729454 9:20125018-20125040 ACTGAGGCTCAGAGAAGTTAAGG - Intergenic
1052180622 9:25522156-25522178 AAATAGGTTCAGAGAGGTTATGG + Intergenic
1052325499 9:27213176-27213198 AACCAGGCTAAGAGAGCTTAAGG - Intronic
1052341360 9:27367187-27367209 ATCAAAGCTCAAAGAGGTGAAGG + Intronic
1052793866 9:32904116-32904138 ATGAAGGTTCTGAGAGCTTATGG - Intergenic
1053424294 9:38000906-38000928 ATGAGGTCTCAGAGAGGCTAAGG - Intronic
1053452326 9:38203418-38203440 ATGGAGGCACAGGGAGGTTAAGG - Intergenic
1053802481 9:41773220-41773242 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
1054142756 9:61541850-61541872 GCTGAGGCTCAGAGAGGTTAAGG - Intergenic
1054190790 9:61984566-61984588 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
1054462506 9:65473000-65473022 GCTGAGGCTCAGAGAGGTTAAGG - Intergenic
1054647584 9:67603151-67603173 GCTGAGGCTCAGAGAGGTTAAGG - Intergenic
1054765116 9:69036594-69036616 GCCACGTCTCAGAGAGGTTAGGG - Intronic
1054826364 9:69577824-69577846 AACAAGGCCCAGAGAGGTGAAGG + Intronic
1055428206 9:76217518-76217540 ACTGAGGCTCAGAGAGGTTATGG + Intronic
1055499180 9:76886274-76886296 ACCAAGACCCAAAGAGGTTAAGG + Intronic
1056796757 9:89663805-89663827 AGTAAGGCCCAGAGAAGTTAAGG - Intergenic
1057293749 9:93823608-93823630 ACCAAGGCTCAAAGAGGCTCTGG + Intergenic
1057859834 9:98632241-98632263 CTGGAGGCTTAGAGAGGTTAAGG - Intronic
1057874524 9:98743671-98743693 ACCAAGGCTCAGAGAAGTTGAGG - Intronic
1057889877 9:98861808-98861830 ATTGAGACTCAGAGAGGGTAAGG + Intergenic
1058575080 9:106392391-106392413 GTCACAGCTCAGAGAGGTTAAGG - Intergenic
1058679839 9:107431208-107431230 ATCAAAGCTCAGAGAAGTTCAGG + Intergenic
1058823637 9:108755345-108755367 AACAAAGCTCAGAGTAGTTAGGG + Intergenic
1058970411 9:110077180-110077202 ACCAAGGCTCAGAGAGGTTAAGG - Intronic
1059335148 9:113564480-113564502 ACCGAGGCTCAGAGAGGGGAAGG + Intronic
1059413031 9:114145565-114145587 GCAAAGGCTCAGAGAGGTAAAGG + Intergenic
1059427222 9:114228606-114228628 ACTGAGGCTCTGAGAGGTTAGGG - Intronic
1059562915 9:115352616-115352638 ATCAAGACTCAGAGAGTTTCAGG + Intronic
1059688440 9:116660437-116660459 ATGGAGGCTTAGAGAGGTTAAGG - Intronic
1059811127 9:117856796-117856818 CGCAAGGCTCAGAGTGGTGATGG - Intergenic
1059811182 9:117857420-117857442 ATTAAGGCTCAGAGAGGTGAAGG - Intergenic
1060003532 9:119980085-119980107 ATGAAAGCACAGAGGGGTTAAGG + Intergenic
1060019257 9:120115082-120115104 ACGAAGGCTAAGGGAGGTTAGGG + Intergenic
1060034226 9:120241346-120241368 GCCAAGGTTCAGAGAGGTTAAGG + Intergenic
1060155313 9:121315871-121315893 ACCAAGGCACAGAGTGGTTAAGG - Intronic
1060302587 9:122383897-122383919 ACCGAGGCTCACAGAGGTTGAGG - Intronic
1060402704 9:123357542-123357564 ACCAAGGCTCAGAGAGGGACGGG + Intronic
1060449646 9:123724689-123724711 ACCTGTGCTCAGAGAGGTTATGG - Intronic
1060940674 9:127541406-127541428 ACTGAGGCTCAGAGAGGTTAAGG + Intronic
1060969851 9:127731803-127731825 GTCAAGGCTCAGTGAGGTTCTGG + Exonic
1060975335 9:127761840-127761862 ATGCAGGCTCAGAGAGGTGAAGG - Intronic
1061088156 9:128411390-128411412 ATCAGGGCTGAGAGAGGGAAGGG + Intergenic
1061112541 9:128584990-128585012 ATTCAGGCTCAGAAAGGGTAAGG - Intronic
1061242885 9:129384433-129384455 ATGGATGCTCAGAGAGGTTAAGG - Intergenic
1061267989 9:129519354-129519376 ACCGAGGCTCAGTGAGGTAAAGG - Intergenic
1061276356 9:129571187-129571209 ACCAAGGCACAGAGAGGGCAAGG - Intergenic
1061363043 9:130155845-130155867 AGCAAGGCCCAGAGAGGTTGAGG - Intergenic
1061382133 9:130265118-130265140 ACTGAGGCTCAGAGAGGTGAAGG - Intergenic
1061435018 9:130555618-130555640 ACCAAGGCTGGGAGAGATTAGGG - Intergenic
1061441140 9:130604499-130604521 ACACAGGCTCAGAGACGTTAAGG - Intronic
1061618840 9:131797695-131797717 AATAAGGCTCAGAGAGGTCAAGG - Intergenic
1061811478 9:133164671-133164693 AGACGGGCTCAGAGAGGTTATGG + Intergenic
1062006787 9:134242468-134242490 ATCAGGGCTCAGAGAGAGAAAGG + Intergenic
1062128911 9:134882182-134882204 ACAGAGGCTCAGAGGGGTTAAGG + Intronic
1062186590 9:135221701-135221723 TTCCGGGCTCAGAGAGGTCAGGG - Intergenic
1062197140 9:135280590-135280612 ACTGAGGCTCAGAGAGGTTGAGG - Intergenic
1062235953 9:135507693-135507715 ACCGAGGCTCAGAGGGGTGAAGG - Intergenic
1062288903 9:135785894-135785916 ATAAGGGCTCAGAGAGGCGAAGG + Intronic
1062380868 9:136285990-136286012 ACCAAGGCTCAGAGAGAAAATGG + Intronic
1203716639 Un_KI270742v1:156935-156957 ATCAAGACACAGAGAGTTAAGGG + Intergenic
1203534572 Un_KI270743v1:21302-21324 ATCAAGACACAGAGAGTTAAAGG - Intergenic
1186330474 X:8527031-8527053 ATCAAAGATCAGAGAGGCTGGGG - Intergenic
1186669170 X:11752481-11752503 ACTAAGGCTCAGAAATGTTAAGG - Intergenic
1187238087 X:17487198-17487220 ACTGAGGCCCAGAGAGGTTAAGG + Intronic
1187353573 X:18544514-18544536 ATTGAGGCACAGAGAAGTTAAGG + Intronic
1187424170 X:19162190-19162212 ATTAAGGCACAGAGAGATTAAGG - Intergenic
1189159713 X:38799685-38799707 AGCAAGGATCAAAGAGTTTAAGG - Intergenic
1189286674 X:39856695-39856717 TTCAAGGCTGAGAGAGGCCAGGG + Intergenic
1189630304 X:42945588-42945610 ATGAAGCCTCAGAAAGGTTCTGG - Intergenic
1190023199 X:46897867-46897889 ATCAAAGCTCAAACAGGATAAGG - Intronic
1190163440 X:48051357-48051379 ATCAAGTCTGAGAGTGGTTTAGG + Intronic
1190433551 X:50401563-50401585 GCCAAAGCTCAGAGAGGTAAAGG + Intronic
1191863686 X:65686679-65686701 GTGGAGGCTCAGGGAGGTTAAGG - Intronic
1192054783 X:67761893-67761915 ATGGAGGCCCAGAGATGTTAAGG - Intergenic
1192072826 X:67959137-67959159 ATGAAGGTTTAGAGAGGTGAAGG - Intergenic
1192212192 X:69134864-69134886 ATTGAGGCTCAGAGAGGTAAAGG + Intergenic
1192236723 X:69300812-69300834 ATCAAGGCTCGGAGAGGTGAAGG - Intergenic
1192338113 X:70238772-70238794 ACCAAGGCTCAGAATGGTTAAGG - Intronic
1192577596 X:72255434-72255456 ATCAAGGCTCAGACAGGTGGCGG + Intronic
1192598000 X:72431900-72431922 ATCGAGGCTTAGAGAGGTGAAGG + Intronic
1193143747 X:78056214-78056236 ATGAAGGCTGAGAGAGGTGAGGG + Intergenic
1193966255 X:87990133-87990155 AATGAGGCTCAGAGAGGATAAGG + Intergenic
1194966033 X:100289722-100289744 ATTGAGACTCAGAGAGCTTAGGG - Intergenic
1195128397 X:101831183-101831205 ACCAAGGCTTAGAGAGGTACAGG + Intergenic
1195177801 X:102327649-102327671 ACCAAGGCTTAGAGAGGTATAGG - Intergenic
1195181063 X:102359444-102359466 ACCAAGGCTTAGAGAGGTATAGG + Intergenic
1195203536 X:102572626-102572648 ACCAAGGCTTAGAGAGGTACAGG - Intergenic
1195613618 X:106895558-106895580 ACTGAGGTTCAGAGAGGTTAAGG - Intronic
1196052700 X:111322233-111322255 ATAGGGGCTCAGAGAGGGTATGG + Intronic
1196742058 X:119033784-119033806 ACCAAGGCTCAGAGAGGTTAAGG + Intergenic
1196754234 X:119143861-119143883 ATTAAGGCTCAGAAAGGTTAAGG + Intronic
1196755921 X:119157175-119157197 AGCAAGGCTCTGAGATGCTAAGG - Intergenic
1196788687 X:119444726-119444748 ATTGAAGCTCAGAGAAGTTAAGG + Intronic
1196891665 X:120297230-120297252 ACCAAAGCACAGAGTGGTTAAGG - Intronic
1196899653 X:120370202-120370224 ATCAAGGCAAAGTGAGGTTTTGG - Intronic
1197444126 X:126527683-126527705 ATGAAGGCTGAGAGAGGTGAGGG - Intergenic
1197560770 X:128017802-128017824 ATCAAGGTTGAGAGAATTTATGG + Intergenic
1198122549 X:133608218-133608240 AGCAAGGCTCAGAGACCTTCAGG - Intronic
1201593045 Y:15636715-15636737 AGCCAGGCGCAGAGTGGTTAAGG + Intergenic
1202389633 Y:24356593-24356615 ATCAAGGCACTGAGAGGTTATGG + Intergenic
1202481151 Y:25313521-25313543 ATCAAGGCACTGAGAGGTTATGG - Intergenic