ID: 1103206751

View in Genome Browser
Species Human (GRCh38)
Location 12:119135605-119135627
Sequence CTCAGTAAACACCTGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103206751_1103206753 -5 Left 1103206751 12:119135605-119135627 CCATGCACCAGGTGTTTACTGAG 0: 1
1: 0
2: 1
3: 27
4: 247
Right 1103206753 12:119135623-119135645 CTGAGCACCTACTATGCACCAGG 0: 2
1: 49
2: 304
3: 1284
4: 3722
1103206751_1103206755 2 Left 1103206751 12:119135605-119135627 CCATGCACCAGGTGTTTACTGAG 0: 1
1: 0
2: 1
3: 27
4: 247
Right 1103206755 12:119135630-119135652 CCTACTATGCACCAGGTGCTAGG 0: 1
1: 1
2: 22
3: 102
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103206751 Original CRISPR CTCAGTAAACACCTGGTGCA TGG (reversed) Intronic
900764676 1:4496036-4496058 CACAGGAAACACCTGCTCCATGG - Intergenic
901405179 1:9040348-9040370 CTCGGGAAACACCTGCAGCAGGG + Intronic
902135186 1:14299062-14299084 CTCAATAAACAGCTGTTGAATGG - Intergenic
903023791 1:20412612-20412634 CTCAGTAAACAGCTGATGAATGG - Intergenic
903270661 1:22186215-22186237 CACAGGAAACACCTGGTTCAGGG - Intergenic
907766562 1:57418157-57418179 CTCAGTAAACATTTGTTGAATGG + Intronic
908570421 1:65404215-65404237 CTCAATAAACACTTGGTGATAGG - Intronic
909923906 1:81415777-81415799 ATCAATAAACACCTGCTGAATGG + Intronic
911151544 1:94601020-94601042 CTCACTGAAAACCTGGTGCATGG + Intergenic
911252503 1:95593365-95593387 ATCAGTAAAGGCATGGTGCATGG + Intergenic
911874069 1:103136338-103136360 CTCAGGAAACAACAGGTGCTGGG - Intergenic
912516525 1:110219893-110219915 CTCAGGACCCACCTGGAGCAAGG + Intronic
916739631 1:167636879-167636901 CTAACTAAAAACCTAGTGCATGG - Intronic
920280206 1:204837574-204837596 CTCAGAAACCACCAGGTGCCTGG - Intronic
923871318 1:237997169-237997191 CTCATTAAACCCCTTGTACAAGG + Intergenic
1063017495 10:2093521-2093543 CTCAACAAACACTTTGTGCAGGG - Intergenic
1064037337 10:11925471-11925493 CTCAGTAAATATTTGGTGAATGG - Intronic
1067384555 10:45806507-45806529 CTCAGTAAATATCTGGTGAATGG + Intergenic
1067879641 10:50032299-50032321 CTCAGTAAATATCTGGTGAATGG - Intergenic
1068308637 10:55249990-55250012 CCCAGTAATCCACTGGTGCATGG + Intronic
1068929416 10:62573754-62573776 GTCAGTAAACAACAGTTGCATGG - Intronic
1069534157 10:69240900-69240922 CTCAGTAAACACTTGTCGAATGG - Intronic
1070504604 10:77102123-77102145 CTCAGTAAACACATGTGGAATGG + Intronic
1070654892 10:78264613-78264635 AGTAGTAAACACATGGTGCAGGG - Intergenic
1071368096 10:84922058-84922080 CTTAGTAAAGAGCAGGTGCAGGG + Intergenic
1071792481 10:88969869-88969891 CTCAGTAAATATCTCTTGCAAGG + Intronic
1072912321 10:99514341-99514363 CTAGGTCAACACCTGGTCCATGG + Intergenic
1073459417 10:103658106-103658128 GTCAGTAAACACCAGGTGGCAGG - Intronic
1075333375 10:121591403-121591425 TCCAGTAAGCACCGGGTGCATGG - Intronic
1077220965 11:1416047-1416069 CTCAGGGCTCACCTGGTGCACGG + Intronic
1077960556 11:7072632-7072654 TTCAGTAAACACACCGTGCACGG - Intergenic
1081435018 11:43017937-43017959 CTCAGAATAGACCTGGTGTATGG - Intergenic
1083971605 11:66080207-66080229 CTCAGTAAATATTTGGTGAATGG - Intronic
1086423167 11:86657882-86657904 CTCAGTAAACATTGGGTGGATGG + Intronic
1088143961 11:106652259-106652281 CCCAGTATACCCTTGGTGCATGG - Intergenic
1089093878 11:115901745-115901767 CTCAGTGAGCCCCTGGTGGAAGG - Intergenic
1089688369 11:120170901-120170923 CTCAGCAAACCTGTGGTGCAGGG + Exonic
1091254134 11:134168797-134168819 CACAGTAAAGACCTGGGGCAGGG + Intronic
1091368370 11:135039932-135039954 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368384 11:135039998-135040020 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368398 11:135040064-135040086 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368405 11:135040097-135040119 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368418 11:135040163-135040185 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368426 11:135040207-135040229 CTCAGAACACACCTGGTGACGGG - Intergenic
1091368432 11:135040240-135040262 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368439 11:135040273-135040295 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368446 11:135040306-135040328 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368453 11:135040339-135040361 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368466 11:135040416-135040438 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368473 11:135040449-135040471 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368486 11:135040515-135040537 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368494 11:135040559-135040581 CTCAGAACACACCTGGTGACGGG - Intergenic
1091368500 11:135040592-135040614 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368507 11:135040625-135040647 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368514 11:135040658-135040680 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368521 11:135040691-135040713 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368529 11:135040735-135040757 CTCAGAACACACCTGGTGAGGGG - Intergenic
1091368536 11:135040768-135040790 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368543 11:135040801-135040823 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368550 11:135040834-135040856 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368570 11:135040944-135040966 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368577 11:135040977-135040999 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368591 11:135041054-135041076 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368598 11:135041087-135041109 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368605 11:135041120-135041142 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368625 11:135041230-135041252 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368632 11:135041263-135041285 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368646 11:135041340-135041362 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368653 11:135041373-135041395 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368660 11:135041406-135041428 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368675 11:135041483-135041505 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368689 11:135041560-135041582 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368708 11:135041659-135041681 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368715 11:135041692-135041714 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368734 11:135041791-135041813 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368741 11:135041824-135041846 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368749 11:135041868-135041890 CTCAGAACACACCTGGTGAGGGG - Intergenic
1091368762 11:135041934-135041956 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368770 11:135041978-135042000 CTCAGAACACACCTGGTGAGGGG - Intergenic
1091368777 11:135042011-135042033 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368784 11:135042044-135042066 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368814 11:135042198-135042220 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368823 11:135042242-135042264 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368839 11:135042319-135042341 CTCAGAACACACCTGGTGAGGGG - Intergenic
1091368846 11:135042352-135042374 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368853 11:135042385-135042407 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368861 11:135042429-135042451 CTCAGAACACACCTGGTGAGGGG - Intergenic
1091368868 11:135042462-135042484 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368875 11:135042495-135042517 CTCAGGACACACCTGGTGATGGG - Intergenic
1091368905 11:135042649-135042671 CTCAGGACACACCTGGTGATGGG - Intergenic
1094346593 12:29476592-29476614 CTCAGTAAACACCTGCTAATAGG + Intronic
1099680875 12:85826106-85826128 ACCAGTAAACACCTGGTGTTTGG - Intronic
1103206751 12:119135605-119135627 CTCAGTAAACACCTGGTGCATGG - Intronic
1105014874 12:132780381-132780403 GTCAGTGAACACCTGAAGCAGGG + Intronic
1106475157 13:30092137-30092159 CTCAGTAAGGACCAGGTGCTGGG + Intergenic
1108481540 13:50877611-50877633 CTCAGTAGAGACCTTGTGTAGGG + Intergenic
1111730469 13:92070042-92070064 CTCAGAAATCAACTGGAGCATGG - Intronic
1114652157 14:24292084-24292106 CACAGTAAGCACCTGGTGAGTGG + Intronic
1115309842 14:31968093-31968115 CTCAGACAAAGCCTGGTGCATGG - Intergenic
1116132228 14:40869828-40869850 TTCAGTAAACATCTGGGCCATGG + Intergenic
1119114759 14:72009057-72009079 CTCAGTAAAAACCTTGGGCCAGG + Intronic
1119198386 14:72734050-72734072 CTCAGTAAATATCTGTTGAATGG - Intronic
1119525964 14:75322898-75322920 CTCAGTAAATCCTTGTTGCATGG + Intergenic
1121018875 14:90566878-90566900 CTCAGCAATCACCTGGGGAAAGG - Intronic
1126317564 15:47386686-47386708 CTCTGGGAACACCTGGTGCCAGG + Intronic
1126351387 15:47748346-47748368 CTCAGTAAATACTTGATGAATGG - Intronic
1127048178 15:55050022-55050044 CTCAGTAAATATCTGGTGTTTGG + Intergenic
1127715456 15:61645016-61645038 CACAGTAAACACCTGGTCAATGG + Intergenic
1127836407 15:62794413-62794435 CTCAGTAAACACCTGCTGGCTGG + Intronic
1130342459 15:83011277-83011299 CTCAGAAATCACCAGGTGGACGG + Intronic
1131771117 15:95738113-95738135 TTCACTAAACACCAGTTGCAGGG - Intergenic
1132997276 16:2829871-2829893 CTCAGGCAGCACCTGGTGCCTGG - Intergenic
1134429187 16:14185614-14185636 CTCAATAAACATCTGTAGCATGG - Intronic
1137558432 16:49488078-49488100 CTCAGTAAATACTTGCTGAATGG + Exonic
1138421477 16:56902115-56902137 CTCTGTAAATACCTGCTGGATGG + Intronic
1140521452 16:75585413-75585435 CTTAGTAAACAACTGGTGAAGGG - Intergenic
1141027848 16:80564739-80564761 CTCTGTTACCACCTGCTGCATGG - Intergenic
1141624033 16:85252157-85252179 CTCAGTAAACATCCGCTGCCTGG + Intergenic
1141823273 16:86462429-86462451 CTCAGCAAACACCTGCTCCAAGG - Intergenic
1142468557 17:149111-149133 CTCATTAAACTCCGGGTTCAGGG + Exonic
1143789783 17:9285288-9285310 CTCAGGCAACATCTGGTGGACGG + Intronic
1143811963 17:9479099-9479121 CTTGGTAAACACCTGTTGAATGG + Intronic
1143973387 17:10812315-10812337 TTCAGTGAACACCAGGTGCTGGG - Intergenic
1144768683 17:17746928-17746950 CTCAGAAAACACATGGGGCTGGG - Intronic
1145241876 17:21244949-21244971 CTCAGGAAACATTTGGTGGATGG - Intronic
1145990806 17:29078389-29078411 CCCAGTAACCATCTGCTGCATGG + Exonic
1146270108 17:31479443-31479465 CACAGTAATCACCTGGGGAATGG - Intronic
1146481531 17:33208801-33208823 CTCAGTAAATATCTGTTGAATGG + Intronic
1152452203 17:80388770-80388792 CACAGCAAACACCCGGGGCAAGG - Intronic
1155170912 18:23266312-23266334 CACAGTAAACCCCTGGCCCAGGG + Intronic
1156463330 18:37333820-37333842 CTCAGTAAACACTGGATGGATGG - Intronic
1157336050 18:46738357-46738379 CACATCCAACACCTGGTGCAGGG + Intronic
1158112152 18:53952136-53952158 CTCAGGGAACAGCTGGTGCTGGG + Intergenic
1159765916 18:72488093-72488115 CTCAATAAAGTCATGGTGCATGG + Intergenic
1160329023 18:77975539-77975561 CCCACCAAACACCTGGTTCAGGG + Intergenic
1162960308 19:14121778-14121800 CTCAGTAAATACATGATGCTTGG - Intronic
1163485239 19:17581483-17581505 CTCAGTAAGCACGTGGAGCCTGG - Exonic
1164553819 19:29234445-29234467 CTCAGTAAGTATCTGGTGGATGG + Intergenic
1164642353 19:29835646-29835668 CTCAGTAAATACCTGCTCCATGG + Intergenic
1165119451 19:33549653-33549675 CTCAGTAAACGCTTGCTGGATGG + Intergenic
1165967685 19:39597153-39597175 CTGAGTAAACACCTGGGGGCTGG + Intergenic
1167619674 19:50553778-50553800 CTCACCAAACACTGGGTGCAGGG + Intronic
1167646964 19:50711167-50711189 CTCAGTAAATATCTGTTGGATGG + Intronic
925988066 2:9231833-9231855 CTCAGTCCTCACCTGCTGCAGGG - Intronic
927643425 2:24860168-24860190 CTCAGCACACACCTGCTGCCAGG - Intronic
932037116 2:68256989-68257011 AACAGTAAAGACCTGGGGCAAGG + Intronic
934709513 2:96505686-96505708 CTCTGTAAACTCCTGATGCCTGG - Intronic
935573558 2:104687256-104687278 CTCAGTCAACATGTGGTGGAGGG - Intergenic
935656749 2:105429807-105429829 CACAGCAGCCACCTGGTGCAGGG - Intronic
937024966 2:118690379-118690401 CTCAATAAATACCTAGTGGAAGG + Intergenic
937024990 2:118690498-118690520 CTCAATAAATACCTAGTGGAAGG + Intergenic
938139001 2:128781478-128781500 GTCAGTAAACACTTGGGCCATGG - Intergenic
938673117 2:133603898-133603920 CTCAGTAAACAGCTGCTGCCTGG - Intergenic
938780169 2:134577521-134577543 CTCAGTCAGCGCCTCGTGCAGGG - Intronic
944045442 2:195405841-195405863 CTCATTAAATACCTGGATCATGG + Intergenic
944207220 2:197169407-197169429 CACTGTAAACTCCTGATGCAAGG + Intronic
946469074 2:219939787-219939809 CTATGCAAAAACCTGGTGCAGGG + Intergenic
947219809 2:227781452-227781474 TTCAGTAAACACACTGTGCATGG + Intergenic
948336082 2:237208208-237208230 CCCAGGAAACACTTGGTTCAGGG + Intergenic
1168913603 20:1468879-1468901 CTCAGTAAACACTAGCTGCCAGG - Intronic
1169669252 20:8076963-8076985 CTCAGTACCCACCTCGTGCCAGG + Intergenic
1170181982 20:13541714-13541736 CTCAGTAAACACTTGTTGAATGG + Intronic
1172099490 20:32476624-32476646 CTCAGTAAATACCTGTCGAATGG - Intronic
1172913577 20:38427903-38427925 CCCAGTAAACACCCCGGGCATGG + Intergenic
1173862550 20:46293694-46293716 CTCAGAAAATACCTGTTGAATGG - Intronic
1174871469 20:54186451-54186473 CTCAGTAATAACCGGGGGCAGGG + Intergenic
1175097329 20:56551951-56551973 ATCAGTAAGTACCTGGTGAATGG - Intergenic
1175509703 20:59515524-59515546 CTCTGTGCACACCTGGTGCCTGG + Intergenic
1175510964 20:59525970-59525992 CTTAGTGTACACCTGGTGCATGG - Intergenic
1175568907 20:60003992-60004014 GTCAGTGAGCATCTGGTGCAAGG + Intronic
1175710056 20:61212512-61212534 CTCAGGAAACACTTGCTGAATGG + Intergenic
1176852284 21:13929983-13930005 CCCAGTAAACACCTGGTTGGGGG - Intergenic
1177551548 21:22629017-22629039 CTCAGCAAACAAATTGTGCATGG - Intergenic
1181130334 22:20727444-20727466 CTCTGGAAATACCTGGTCCACGG + Intronic
1182458316 22:30466904-30466926 CTCAGTAAGCAGCTGGGTCATGG + Intronic
1183539070 22:38419266-38419288 CTCTGTCTACACCTGGTGCAGGG - Intergenic
1184723874 22:46331919-46331941 CTCAGTAAATATTTGCTGCATGG - Intronic
1184772869 22:46608065-46608087 CTCATTAAACACTTAGTGCGTGG + Intronic
949808518 3:7980850-7980872 CTCAGTCAATACCTGGGGAAGGG + Intergenic
950201535 3:11048072-11048094 CTCAGAAACCACCTGCTGCCAGG - Intergenic
950713673 3:14832288-14832310 CTGTGACAACACCTGGTGCAGGG - Intronic
951990789 3:28674229-28674251 CTCAGTAAAGACTTGTTGAATGG + Intergenic
955319091 3:57961471-57961493 CCCAGTAAACACACTGTGCATGG - Intergenic
956776307 3:72568266-72568288 CTCAGTAACCACCTGGGTCACGG - Intergenic
961461206 3:127051524-127051546 CTCAGTAAATACCCAGTGAATGG + Intergenic
962145398 3:132835023-132835045 CTCAGTAGAAACCTAGTACAGGG + Intergenic
968536195 4:1131457-1131479 TTCAGTAAACACTGGGTGCCAGG + Intergenic
968761886 4:2446743-2446765 CTCAGTAAATACCAGTTGGATGG + Intronic
969452195 4:7280851-7280873 CTCAGTCAGCACCTGGTACCCGG + Intronic
969570426 4:8005034-8005056 CTCAGTAAGTATCTGGTGGAGGG + Intronic
970322636 4:14890198-14890220 CTCAGCAAACACTTGGCACATGG - Intergenic
974411784 4:61551099-61551121 GTAAGTAAACACCTGATCCAAGG + Intronic
975180281 4:71336104-71336126 CTCAGTAAACATTTGCTGAATGG + Intronic
976241138 4:82957903-82957925 CTCAGTAAATACTTGTTGTATGG + Intronic
976812271 4:89110642-89110664 CCCAGGAAACAGGTGGTGCAAGG + Intronic
978408046 4:108400046-108400068 CTCAGGAAATACGTGGTCCAAGG + Intergenic
982382319 4:154762203-154762225 CTCAGTATAAACTTGTTGCAGGG - Intergenic
984966166 4:185142605-185142627 CACAGGAAAGACCTGGTGCAGGG - Intergenic
985325286 4:188761229-188761251 CTTATTAAACAAATGGTGCAAGG - Intergenic
986421359 5:7587211-7587233 CTCAGGGATCACCTGCTGCAGGG + Intronic
986424614 5:7618258-7618280 ATCAGAAAACACCTGATGAAAGG - Intronic
988546848 5:32165740-32165762 CTCAGTAAACATTTGATGAATGG + Intronic
992983904 5:82207086-82207108 CACAGTCAAAACCTGGGGCAGGG - Intronic
994902648 5:105795623-105795645 CTCAGAAAACATGTGGTGCATGG - Intergenic
995089928 5:108162201-108162223 CTCAATAAACACCTGGGGCTGGG + Intronic
995433439 5:112108353-112108375 CTCAGAAAACACCTAGATCAGGG - Intergenic
997258754 5:132449301-132449323 CTCAGTAAATAGCTGATGAATGG + Intronic
998901660 5:146861982-146862004 CTCAGTAAATACCTGCTGAATGG + Intronic
998919622 5:147053711-147053733 CTAAGAAAACACGTGGGGCATGG + Intronic
999114655 5:149152013-149152035 TTCACTAAAAACCTGGTGTAGGG - Intronic
999264548 5:150257728-150257750 CTGAGTATACACCAGGTGCCAGG + Intronic
1000656669 5:163887626-163887648 CTCTGCAGACACCTGTTGCAGGG + Intergenic
1000703546 5:164482895-164482917 CTTATTAAACACCTGGAACAGGG - Intergenic
1001566591 5:172703485-172703507 CTGAGTCCACACGTGGTGCAAGG + Intergenic
1001570384 5:172727019-172727041 CTCGGCCAACACCTGCTGCAGGG - Intergenic
1001940621 5:175737086-175737108 CTCAGTAAACGCCTGAGGAAGGG + Intergenic
1003136670 6:3439709-3439731 CTCTGTAAACACTTCCTGCATGG - Intronic
1003911154 6:10745014-10745036 CTCAGTAAACATGTGTTGAATGG - Intergenic
1004240507 6:13916995-13917017 CTCAGTAAACACCTGACGAAGGG - Intergenic
1006736082 6:36273502-36273524 CCTTGGAAACACCTGGTGCAGGG + Intronic
1006931502 6:37691831-37691853 CTCTGTATAAACCTGGCGCATGG - Intronic
1008071697 6:47104900-47104922 CTCAGTAAACATCAGGTGACAGG + Intergenic
1010394735 6:75377680-75377702 CTCAGTAAACATTTGTTGAATGG + Intronic
1010832091 6:80543245-80543267 CTCAGTAAATATCTGCTGAATGG - Intergenic
1015978855 6:138818817-138818839 CTCAGACAACACCTGGGGGAGGG + Intronic
1016544218 6:145202423-145202445 CTCAGTAAACATCTGGTTGAAGG + Intergenic
1017538403 6:155373258-155373280 CTCAGTAAATACTTGTTGAATGG - Intergenic
1019533857 7:1517579-1517601 CTCAGGAAATTCCTGGTGCCAGG - Intergenic
1020155989 7:5725226-5725248 CTCAGCAGACACCTGTAGCACGG + Intronic
1020376782 7:7496313-7496335 CTCAGTAAATGTCTGGTGCATGG - Intronic
1022312920 7:29214204-29214226 ATCAGTAAACACCTAGAGTAAGG + Intronic
1024364821 7:48508781-48508803 CTCAGACAGCACCTAGTGCATGG - Intronic
1026322666 7:69281211-69281233 CTCAGTAAGCTCCTTGTGAATGG + Intergenic
1027731866 7:81884647-81884669 CTCAGTAAAGACCAGACGCATGG - Intergenic
1028977487 7:96930304-96930326 CTCAGTAAATATTTGTTGCATGG + Intergenic
1032213085 7:129933792-129933814 CTCAGCAAACACCTGTTAAACGG - Intronic
1032683866 7:134210885-134210907 CACAGTAGACACCTGGTTCTGGG - Intronic
1032782750 7:135177304-135177326 CTCTGTAGACACCTGGTACTGGG - Intergenic
1034516662 7:151586139-151586161 CTCAGTCAACACCTGGAGCAAGG - Intronic
1037632601 8:20671883-20671905 CTCAGCAAACATGTGATGCAGGG + Intergenic
1037762497 8:21751160-21751182 CTTAGGAAGCAGCTGGTGCAGGG + Intronic
1038441891 8:27576419-27576441 CTTAGTAACCACTTGGTGCTAGG + Intergenic
1038584338 8:28775903-28775925 CTCAGGACACACCACGTGCAGGG + Exonic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044587131 8:93878411-93878433 CTTTTTAATCACCTGGTGCAGGG + Intronic
1045315441 8:101039898-101039920 CTCAATAAAGACCTGTTGAAGGG + Intergenic
1045338614 8:101231997-101232019 CTCAGTAAATATCTGCTGCATGG - Intergenic
1046429157 8:114100418-114100440 CTGATTAAACACATGGGGCAGGG - Intergenic
1046718848 8:117596464-117596486 ATGAGTAAACTCCTGGTTCAGGG + Intergenic
1046812383 8:118546822-118546844 CCCAGCAAACACTTGGTGCCTGG + Intronic
1048546464 8:135392005-135392027 CTCCTTGAACACCTGGTACATGG - Intergenic
1049315028 8:141961249-141961271 CTAATTCAACACCTGGTGTATGG + Intergenic
1049603454 8:143518625-143518647 CTCAGGGCACACCTGGTGCCTGG - Intronic
1049666091 8:143843430-143843452 CTCAGCAAACACTTGTTGAATGG + Intergenic
1049859815 8:144890647-144890669 CTCTCTGAACACCAGGTGCAAGG + Intronic
1056012698 9:82348850-82348872 CTCATTAAATACATGGTGCTGGG - Intergenic
1056257895 9:84819048-84819070 CTCAGTAAACACAGGCTCCAGGG - Intronic
1057806481 9:98223309-98223331 CCCAGTAAAGACCTGGAGGAAGG + Intronic
1060724520 9:125998132-125998154 CCCAGTCTAGACCTGGTGCATGG - Intergenic
1060930314 9:127485739-127485761 CTCAGTCAGCATCTGCTGCATGG - Exonic
1061640477 9:131950821-131950843 CTCAATAAACATGTGGTGAACGG + Intronic
1061923880 9:133796674-133796696 CTCTGCACACACCTGGTGCATGG - Intronic
1062154623 9:135039784-135039806 CTCTGCAAACGCCAGGTGCAGGG + Intergenic
1062666065 9:137673186-137673208 CTCAATAAACACCTGCTGGGAGG - Intronic
1062717990 9:138020782-138020804 CCCAGGAAACACCTGGAGCAGGG - Intronic
1187396283 X:18922316-18922338 TTCAGTTACCACCTGGTGCATGG - Intronic
1189248124 X:39579263-39579285 CTCAATGAACACTTGATGCATGG + Intergenic
1195199435 X:102533332-102533354 CTCTGGAAACACCCGGGGCATGG + Intergenic
1195545936 X:106112783-106112805 CTCAGTGAAAACCTAGTGCTAGG - Intergenic
1197345077 X:125320511-125320533 CTCATTCAGCACCTGCTGCAGGG - Intergenic
1198515137 X:137399831-137399853 CTCTGGACACACCTGGGGCATGG - Intergenic
1199672779 X:150160861-150160883 CCCAGAAAACACCTGGGGCCTGG - Intergenic
1200010798 X:153119386-153119408 CTCTGTAAAGACCTCGTCCAAGG - Intergenic
1200028802 X:153280536-153280558 CTCTGTAAAGACCTCGTCCAAGG + Intergenic
1202357149 Y:24063799-24063821 TTCAGCTCACACCTGGTGCATGG - Intergenic
1202513628 Y:25606315-25606337 TTCAGCTCACACCTGGTGCATGG + Intergenic