ID: 1103206884

View in Genome Browser
Species Human (GRCh38)
Location 12:119136771-119136793
Sequence TTTCTTTGAAGCCTCTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103206884_1103206889 20 Left 1103206884 12:119136771-119136793 CCTCAGGAGAGGCTTCAAAGAAA 0: 1
1: 1
2: 1
3: 36
4: 256
Right 1103206889 12:119136814-119136836 TTCCCTCTGGCTCCTGCTTAAGG 0: 1
1: 0
2: 4
3: 28
4: 271
1103206884_1103206888 7 Left 1103206884 12:119136771-119136793 CCTCAGGAGAGGCTTCAAAGAAA 0: 1
1: 1
2: 1
3: 36
4: 256
Right 1103206888 12:119136801-119136823 CCTGAAGCTGTCATTCCCTCTGG 0: 1
1: 0
2: 0
3: 18
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103206884 Original CRISPR TTTCTTTGAAGCCTCTCCTG AGG (reversed) Intronic
900581869 1:3413415-3413437 TGTCTCTGATGCCTCTCTTGGGG + Intronic
902859938 1:19237981-19238003 TTTCTTTGCAGACTGTCCTGTGG - Intronic
902989633 1:20177516-20177538 TTTCTTTGAGTCCTCTGCTGAGG - Intergenic
905211047 1:36374381-36374403 TTTCTCTGCAGGCTCTCCTGGGG + Intronic
906213211 1:44023815-44023837 TTGTTTTGAATCCTCTCCTGAGG - Intronic
908084095 1:60611720-60611742 TCTCTTTACAGCCTCTCCAGAGG + Intergenic
909036965 1:70604381-70604403 TTTCTGTGAAGCCTCAGTTGGGG - Intergenic
909814291 1:79972004-79972026 TTTCTTTGAAGGGTGTCCTTGGG - Intergenic
911206216 1:95093798-95093820 TATAGTTGAAGTCTCTCCTGTGG - Intergenic
911663415 1:100528365-100528387 TGTGTTAGAAGCCTCTGCTGTGG - Intergenic
913690203 1:121272411-121272433 TTTCTCTGCGGCCTCTCCAGTGG + Intronic
914147337 1:145007548-145007570 TTTCTCTGCGGCCTCTCCAGTGG - Intronic
915841266 1:159215366-159215388 TTTCTCACAACCCTCTCCTGTGG + Intergenic
916126941 1:161580181-161580203 TTTCTCTGGAATCTCTCCTGGGG - Intergenic
916136860 1:161661985-161662007 TTTCTCTGGAATCTCTCCTGGGG - Intronic
916716528 1:167451402-167451424 CTGATTTGAAGCCTGTCCTGGGG - Intronic
916765404 1:167855369-167855391 TTTCAGTGATTCCTCTCCTGGGG - Intronic
919695972 1:200575980-200576002 ATTCTTTTATGTCTCTCCTGAGG - Intronic
920498685 1:206472907-206472929 TTCCCTTGAAGCCCCTCCTGAGG - Intronic
921393217 1:214638607-214638629 TTTCTTTGAACTCTGTCCTGTGG + Intronic
1062943387 10:1440601-1440623 TTTATCTGTAGCCTGTCCTGGGG + Intronic
1064850680 10:19705821-19705843 TTCCTTTGAAGCCTCTCTTGTGG - Intronic
1066335243 10:34470163-34470185 TTTCCTTGAAGGCTCTTCAGAGG + Exonic
1067024294 10:42830250-42830272 TTTCTTTTCAGCCAATCCTGAGG + Exonic
1067273511 10:44813669-44813691 TATCTTTGAAGCCCATCCTATGG + Intergenic
1067833724 10:49625074-49625096 TCTTTTAGAAGCCTCTTCTGAGG - Intronic
1068227163 10:54120232-54120254 TTTCTTTGAAGGCTTTCTAGTGG - Intronic
1068560318 10:58507605-58507627 TTGCTTTGAAGTGTATCCTGAGG + Intergenic
1072176804 10:92932673-92932695 TTTGTTTGAAGCATATCCTTAGG - Intronic
1072497890 10:95980725-95980747 TTTCTTTGATGATTCTTCTGAGG - Intronic
1073737955 10:106371572-106371594 TTTCTATGGAGCATCTGCTGTGG + Intergenic
1073963857 10:108965601-108965623 ATTCTGTGAAGTTTCTCCTGTGG - Intergenic
1073996004 10:109316305-109316327 TCTCTTGGAAGTCTCCCCTGAGG + Intergenic
1074127429 10:110540331-110540353 TTTCTCTGACTCCTCTCTTGGGG - Intergenic
1075708565 10:124518097-124518119 TCGCTCTGAAGTCTCTCCTGCGG + Intronic
1075777221 10:124996740-124996762 CATCTCTGAAGCCCCTCCTGGGG - Intronic
1075855709 10:125627908-125627930 AATCTTTGAAGAGTCTCCTGTGG - Intronic
1076438837 10:130465295-130465317 TCTCTTTGAACCATGTCCTGGGG + Intergenic
1076658706 10:132041258-132041280 TTTATTTTAAGGCTTTCCTGTGG + Intergenic
1077097242 11:804323-804345 ATCCTCTGAAGCATCTCCTGCGG + Exonic
1077796438 11:5497556-5497578 TTTCTTTGAATGCTTACCTGAGG - Intronic
1078067722 11:8089242-8089264 TTTGTTTGAAGCCTGGCCTCGGG + Intronic
1078356392 11:10635195-10635217 TTTGTTAGAAGACTCTCCTGGGG + Intronic
1078663601 11:13306548-13306570 CCTCTGTGAAGCCTCCCCTGAGG - Intronic
1079100262 11:17537158-17537180 TTTCTTTGTAGTCTTCCCTGTGG + Intronic
1079687912 11:23384314-23384336 GTTTCTCGAAGCCTCTCCTGCGG + Intergenic
1081162800 11:39771936-39771958 TTTCTCTAAAGCTTCTCCTTGGG - Intergenic
1081229548 11:40568072-40568094 TTCGTTTGAAGCATGTCCTGAGG - Intronic
1083395741 11:62390609-62390631 TTTCTTATAAGCTTCTGCTGGGG - Intronic
1084207760 11:67605953-67605975 TTTCCTGGAACCCTCTGCTGTGG - Exonic
1084772563 11:71353175-71353197 TTGCTTTGAAACCTCCCCAGTGG - Intergenic
1085549656 11:77356901-77356923 ATACCTTGAAGCATCTCCTGGGG - Intronic
1085882119 11:80479794-80479816 TTTCTTTAATGACTTTCCTGAGG - Intergenic
1086118773 11:83284146-83284168 TTTCTTTGATACCTATCTTGTGG + Intronic
1086633192 11:89049089-89049111 TTACTTTGAAGACTCTCTGGAGG - Intronic
1087111291 11:94471573-94471595 CTTCTTTACAGCTTCTCCTGGGG + Exonic
1087815607 11:102655046-102655068 TTTCTTTGAAACCTCCCCATGGG + Intergenic
1088544594 11:110946807-110946829 TTTCATTGAAATCTTTCCTGAGG - Intergenic
1088716430 11:112553681-112553703 TTCCACTGAAGCTTCTCCTGAGG - Intergenic
1089298260 11:117482261-117482283 CTTTATTGGAGCCTCTCCTGGGG - Intronic
1091033809 11:132215146-132215168 TTTCTTTGGAGCCTCCGCTAAGG - Intronic
1091804983 12:3349433-3349455 TTTCTTTGACAGGTCTCCTGAGG - Intergenic
1093030468 12:14284053-14284075 TTTGTTTGCAGACTCTCCTGGGG + Intergenic
1093048476 12:14480675-14480697 TCTCTTTTAAGTCACTCCTGTGG + Intronic
1094061951 12:26323709-26323731 TTTCTCAGAAATCTCTCCTGTGG - Intergenic
1094168754 12:27469015-27469037 TTTCTTTGAAATCACTCTTGGGG + Intronic
1095272282 12:40233883-40233905 TGTTTTTGAAGCCTGTCCTCTGG + Intronic
1095655096 12:44659970-44659992 TTTCTCTGCTGCCTCTGCTGAGG + Intronic
1095812456 12:46384515-46384537 TTTCCTCACAGCCTCTCCTGGGG + Intergenic
1098134740 12:67390273-67390295 TTCCTAAGAAGCCTCCCCTGAGG + Intergenic
1098834397 12:75403802-75403824 TTTCTTGAAAGCCTCTAATGGGG - Intronic
1099488498 12:83256954-83256976 ATCCTTTGAAGCCACTGCTGGGG + Intergenic
1101633752 12:106520308-106520330 TTTCTTTGAAGCCTCTCTTGTGG - Intronic
1103206884 12:119136771-119136793 TTTCTTTGAAGCCTCTCCTGAGG - Intronic
1104110519 12:125700182-125700204 TCTCTTAGAAGCCACACCTGGGG + Intergenic
1106152676 13:27121323-27121345 TTTCTTTGAATTCTCTACTGAGG - Intronic
1106317954 13:28611848-28611870 TTTCTTTAAAGACTCTCCAGAGG + Intergenic
1107538485 13:41361065-41361087 TATCTTTGCATCCTTTCCTGGGG + Intronic
1108187759 13:47905387-47905409 TTTCTTTGAAGCCCATCTTCTGG - Intergenic
1108479635 13:50855842-50855864 TTTCTTTTAAACCTATGCTGGGG + Intergenic
1108911560 13:55558617-55558639 TTCCTTAGATGCCTCTGCTGGGG - Intergenic
1109003775 13:56841955-56841977 TTTCATTTAAGCATCACCTGAGG + Intergenic
1109858475 13:68165746-68165768 ATTCTTTGACACTTCTCCTGAGG + Intergenic
1110068350 13:71139381-71139403 TTTATTTGAAGCATCTCTTTTGG - Intergenic
1111853619 13:93608004-93608026 TCTCTTTGGAGCCACTCCTGTGG + Intronic
1113431353 13:110254353-110254375 TCTCTTTGAAGCATATCATGAGG + Intronic
1114669869 14:24404267-24404289 TATCTTTGAAGCCTTTTCTTGGG + Intronic
1114809605 14:25882132-25882154 TTTATTATAAGCCTCCCCTGAGG + Intergenic
1115611305 14:35051032-35051054 ATTCTTTCTAGCCTGTCCTGAGG - Intronic
1117791640 14:59348310-59348332 TTTCTTTGTAGCCTCTCCAACGG + Intronic
1118081642 14:62368113-62368135 GGTCTTTGAAGCTTCTACTGAGG + Intergenic
1118630195 14:67695530-67695552 TTTCTTGGAAAACTCCCCTGGGG - Intronic
1118719992 14:68587137-68587159 CTTCTTTGAAGACACTGCTGAGG - Intronic
1119636073 14:76274498-76274520 GTTCCTTGAGGCCTCTCCAGAGG - Intergenic
1122720212 14:103717572-103717594 TTTCTTTGTGGCCTCTGCTGAGG + Intronic
1123835588 15:24188420-24188442 GTTCTGTTAGGCCTCTCCTGTGG - Intergenic
1129877099 15:78982805-78982827 TTTGTGTGTCGCCTCTCCTGGGG - Intronic
1130572729 15:85062888-85062910 CATCTTTTAAGACTCTCCTGTGG + Intronic
1131002103 15:88947215-88947237 TTTCTGTGATGCCTCTGTTGGGG - Intergenic
1131707026 15:95008027-95008049 TTTCTTGGACACTTCTCCTGTGG + Intergenic
1132261492 15:100429045-100429067 CTTATTTGAGGCCTCACCTGGGG - Intronic
1132351119 15:101140402-101140424 TTCCTTTCCAGCCTCTCCTCTGG - Intergenic
1133416993 16:5614569-5614591 TTTCTTTTAAGGCTCTTCAGAGG + Intergenic
1133782850 16:8953168-8953190 TCTCTGTGAGGCCTCACCTGAGG + Intronic
1133945466 16:10344295-10344317 ATTCCATGAAGCCTCTCTTGGGG - Intronic
1133954631 16:10430995-10431017 CTTCTGTGAAGACTCTGCTGGGG - Exonic
1134802121 16:17094426-17094448 TTCAGTTGAAGCCTCTCCTCAGG + Intergenic
1136654406 16:31701172-31701194 TTTCCTTCAAGCCCCTCCGGTGG - Intergenic
1136859418 16:33688453-33688475 TTTCTTTTCAGCCAATCCTGAGG - Intergenic
1139297786 16:65918242-65918264 TTCCTTTATAGCCTCTGCTGTGG + Intergenic
1141728009 16:85802660-85802682 TTTCTGTTGAGCCTCTGCTGGGG - Intronic
1202997891 16_KI270728v1_random:133966-133988 CTTCTTGGAATCATCTCCTGTGG - Intergenic
1203120925 16_KI270728v1_random:1536642-1536664 TTTCTTTTCAGCCAATCCTGAGG - Intergenic
1143964574 17:10747796-10747818 TTTCTCTGAAGCCATTCCAGTGG - Intergenic
1144050883 17:11496295-11496317 TTGCTTTGAAGTCTCACCTGTGG - Intronic
1147865562 17:43549814-43549836 ATTCTTTGAAACCTGCCCTGGGG - Intronic
1148145463 17:45361827-45361849 TTTCTTTGAAGGGGCTTCTGGGG - Intergenic
1149296026 17:55263775-55263797 TCTCTTACAACCCTCTCCTGGGG + Intergenic
1149621306 17:58047283-58047305 TTTCTTTGAGGCCCCTTCTTGGG + Intergenic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1150988671 17:70229637-70229659 TCTATATGAAGCCTCTCCTGTGG + Intergenic
1151050806 17:70977263-70977285 TTTCTTTTCAGCCTTTCATGTGG - Intergenic
1155778986 18:29806848-29806870 TTTCTTTGAAGCATATTCTAAGG + Intergenic
1155890004 18:31255761-31255783 TTATTTTGATGCCGCTCCTGGGG - Intergenic
1156432243 18:37087918-37087940 TTCTTTTTCAGCCTCTCCTGGGG + Intronic
1156637383 18:39047868-39047890 TTTCTTTGATGCCTTTTCTTAGG + Intergenic
1157732103 18:50012881-50012903 TTTCAAAGCAGCCTCTCCTGTGG - Intronic
1159015440 18:63098645-63098667 ATTGTTTAAAGCCCCTCCTGAGG + Intergenic
1159255861 18:65944513-65944535 TTTTTTTTAAGCCTTTCCAGTGG + Intergenic
1163777706 19:19227720-19227742 TTTCTCTGAAGTCTGCCCTGGGG - Exonic
1164898082 19:31894897-31894919 TTTCTCTAAGGCATCTCCTGGGG - Intergenic
1165894753 19:39134953-39134975 TCTCTTTGTAGCATCTCCTGGGG + Intronic
1165954403 19:39493101-39493123 TTTTTTTGAAGCCTCTACAAAGG + Intronic
1166441960 19:42823188-42823210 TTTCTCTGAATCTGCTCCTGGGG - Intronic
926816065 2:16798611-16798633 TTTCAGTGAAACCTCTCCTCAGG + Intergenic
927391488 2:22600353-22600375 TTTCTTTCAGGCCCCTCTTGAGG + Intergenic
927625147 2:24708323-24708345 TTCCTTTGAAGCATTTCCTAAGG + Intronic
928193277 2:29193722-29193744 TTTCTTTGCAGCCTTGCCAGAGG + Exonic
928228872 2:29478731-29478753 CCTCTTTGAAGCCTCTTCTCAGG - Intronic
929049679 2:37825494-37825516 TTTCTTTGAAGCCCCTCTAGAGG - Intergenic
932220971 2:69998805-69998827 TTTCTTTCGAGCATTTCCTGCGG - Intergenic
932863321 2:75316735-75316757 TTTCCTAGAAGCCTCTCATGAGG + Intergenic
935945931 2:108286763-108286785 TTTCCTTGAAGCCTTTCCTTAGG - Intergenic
936876421 2:117195096-117195118 TTTCTTAGAAACCTCTTCTGTGG - Intergenic
938473161 2:131584809-131584831 TTTCCTTCAAGTCTCTCCTCTGG + Intergenic
939542828 2:143514405-143514427 TTTCTTTGAGACTCCTCCTGAGG + Intronic
941922893 2:170869890-170869912 TTTCTTTGAGGGCTCCCCAGAGG - Intergenic
942259048 2:174139336-174139358 TCTCTCTGAAGCCTCTCTGGGGG - Intronic
944397723 2:199288469-199288491 TGTGTTTGAAGCCTCACATGAGG + Intronic
947473526 2:230419803-230419825 GTTCTTGGAAGCATCCCCTGTGG + Intronic
947544198 2:230999789-230999811 TGTCAGTGCAGCCTCTCCTGAGG + Intronic
947994811 2:234518207-234518229 CTTCCTTCAAGCCTCTCGTGGGG - Intergenic
948249799 2:236517536-236517558 TTTCTGTGAAGCCTAAACTGAGG - Intergenic
948665848 2:239534546-239534568 TTTCTTTGAAACTTCTGCTATGG + Intergenic
948898222 2:240938321-240938343 TTTTTTTCAAGTCTCTCCTTTGG + Intronic
1169118309 20:3081402-3081424 TTTCTCTGCATCCTCTCCTTGGG - Intergenic
1170042514 20:12053286-12053308 TTTCTTGGAAGACTCACCTTTGG - Intergenic
1179088249 21:38239435-38239457 GTTCTGCGAAGCCTCTTCTGGGG + Intronic
1179140412 21:38720142-38720164 TCTCTCTGAAGCCTCTGCTAAGG + Intergenic
1180855161 22:19040909-19040931 TTCCTTTAAGGCTTCTCCTGGGG - Intronic
1180902085 22:19381079-19381101 TTTCTTTGAAGCCTCTCAGTAGG + Intronic
1182530640 22:30953545-30953567 TTTTATTGCAGCCTCTCCTGGGG - Intronic
1182829227 22:33291196-33291218 TTTCCTTATATCCTCTCCTGTGG - Intronic
1183177777 22:36237132-36237154 TTTGTCTGGAGCCTCTGCTGGGG + Intronic
1183884000 22:40861643-40861665 CTTCTTTGAAGACTCGCTTGAGG - Exonic
1185144188 22:49120949-49120971 TTTCTACTAAGCCTCTCCCGAGG + Intergenic
950420857 3:12898543-12898565 TTTCCTGAAAGCCCCTCCTGGGG + Exonic
950572736 3:13811959-13811981 TGTCTCTGAAGCCTCTCGCGGGG + Intergenic
951243721 3:20316295-20316317 TTTCTTGGAACACTCTCCTTTGG + Intergenic
951480558 3:23157491-23157513 ATTCTTTGAAGCATTCCCTGAGG + Intergenic
951883267 3:27500259-27500281 TTCCTTTGAGGCCAGTCCTGAGG + Intergenic
951976519 3:28516634-28516656 TTTCCTTGAAGCCACTCCCAGGG + Intronic
952278915 3:31904268-31904290 TGGCTTTGATGCCTCTGCTGAGG - Intronic
953686797 3:45084283-45084305 TCATTTTGTAGCCTCTCCTGTGG + Exonic
954021344 3:47744904-47744926 TTTCTTTTATCCCTGTCCTGAGG + Intronic
954829651 3:53409261-53409283 TTTCTATGTATCATCTCCTGAGG + Intergenic
955619838 3:60850957-60850979 TTTCTTTGAAACCATCCCTGTGG - Intronic
956980489 3:74631043-74631065 TTTCTTTTAAGCCTTCCCTACGG + Intergenic
957273058 3:78056024-78056046 TTTCCTTTAAGAGTCTCCTGAGG + Intergenic
957400035 3:79699591-79699613 TTTCTCTGAATCCTCACCTATGG - Intronic
962588016 3:136861904-136861926 TTGCTGTTAAGTCTCTCCTGCGG + Intergenic
964257393 3:154791722-154791744 TGTCCTTGAAGCATTTCCTGAGG + Intergenic
964382627 3:156113039-156113061 TTTCTTTACAGCTTCTCCTGGGG + Intronic
965493304 3:169366540-169366562 TTTCCTGGAAGCCTCACCTAAGG - Intronic
965792255 3:172402218-172402240 TCTATTTGAACCTTCTCCTGAGG - Intergenic
966040314 3:175477050-175477072 TTTCTCTGATGCCTGACCTGAGG - Intronic
966089186 3:176110034-176110056 TTTCTTTTAAGCAGCTCCTATGG + Intergenic
966748708 3:183302161-183302183 CTTCTTAGAATCCTCTCCTGTGG - Intronic
966930963 3:184675199-184675221 TCTCTATGAAGCCACCCCTGGGG - Intronic
967028580 3:185585494-185585516 TTTCTGTGAAGCCTTTCTTGAGG + Intronic
967286959 3:187881269-187881291 TCTCTCTGAAGCCTTTCTTGAGG - Intergenic
972076672 4:35098818-35098840 TTTCTTTCTAGGTTCTCCTGTGG + Intergenic
972444013 4:39126417-39126439 TTTTTTTGTATCTTCTCCTGGGG + Intronic
973291489 4:48475615-48475637 TGTTTTTGAAGCCTTTCCTGGGG - Intergenic
973860101 4:55055317-55055339 TTTCTTTTAAATATCTCCTGTGG - Intergenic
974105114 4:57461237-57461259 ATTCTTGGTAGCTTCTCCTGAGG - Intergenic
976242017 4:82967693-82967715 TTTTTTTGGAGCCCTTCCTGTGG - Intronic
976571098 4:86611906-86611928 TTTCTTTGAATCCTTTTGTGTGG - Intronic
977086640 4:92607306-92607328 CTTCTTTTAAGCCTCTACTTTGG + Intronic
977768230 4:100826252-100826274 TATGTTTGAAGCCTCTAATGAGG + Intronic
978890843 4:113825428-113825450 TTTCCCTGAAGCCTCTGCAGTGG - Intergenic
980675060 4:136067508-136067530 TTTCTTTGATGCCTATTTTGTGG + Intergenic
980982398 4:139665773-139665795 TTTGTTTTAAGCCTCTCCCACGG - Exonic
981427355 4:144618770-144618792 ATTCTTTGGTGCCTCTCTTGAGG - Intergenic
983706857 4:170672058-170672080 GTTCTTAGGAGCCTGTCCTGGGG + Intergenic
984992396 4:185393956-185393978 TTTCTCTGAAGACTCTTTTGCGG + Intronic
987210594 5:15678070-15678092 TGTCTTTGCTGCCTCTGCTGAGG + Intronic
989116276 5:37956232-37956254 TGTCTTTGAAGACTTTCCAGTGG + Intergenic
989217895 5:38923891-38923913 TTACTTTGAAGGCTTTGCTGAGG - Intronic
990772802 5:59268616-59268638 TTTCTTGGAAGCCTTTCCAGAGG - Intronic
991208916 5:64082491-64082513 TGACTTTGAAGCCTCTTCTTTGG + Intergenic
991464901 5:66901549-66901571 TTTGTTTGGAGCCTATCCTTTGG + Intronic
991778411 5:70108455-70108477 TTTCTATAAAGCCTCTGCTGTGG + Intergenic
991857701 5:70983922-70983944 TTTCTATAAAGCCTCTGCTGTGG + Exonic
991870860 5:71108808-71108830 TTTCTATAAAGCCTCTGCTGTGG + Intergenic
992741098 5:79774357-79774379 TTTCTTTGAATGCTCTCCTCAGG + Intronic
992762278 5:79961449-79961471 TTTCTTTGATGCTTCTTATGTGG + Intergenic
993335120 5:86647380-86647402 TTTCTTTGTATCATCTCCTGTGG - Intergenic
995406901 5:111808277-111808299 TGTCTTGGAAGTCTCTGCTGGGG + Intronic
997230377 5:132238297-132238319 TTTCTCTGCACTCTCTCCTGGGG + Intronic
998039909 5:138945357-138945379 TGTCTTCCAAGCCTCTGCTGAGG + Intergenic
998194070 5:140051541-140051563 GTTTTTGGAATCCTCTCCTGAGG + Intergenic
1001417970 5:171561467-171561489 TTTGTCAGAAGCCTCTCCTTTGG + Intergenic
1003333645 6:5150590-5150612 TTTCTTTGTGGTCTCTCCTTTGG + Intronic
1003395636 6:5750006-5750028 TATCTGTGGAGCCCCTCCTGTGG + Intronic
1006096277 6:31658709-31658731 TACCTTTGAAAACTCTCCTGGGG - Exonic
1006808472 6:36804671-36804693 TTTCCTTGGAGCCTATGCTGGGG - Intronic
1007766645 6:44164596-44164618 CCTCTGTGAAGCCTCCCCTGTGG - Intronic
1009488474 6:64256479-64256501 TTTCATTTAAGCAGCTCCTGTGG + Intronic
1010485069 6:76401088-76401110 TTTCCTTGAAGAATCTCCAGGGG + Intergenic
1010747117 6:79576769-79576791 TTTCTTTGATGCCCCTTCTAAGG + Intergenic
1011090628 6:83594458-83594480 TGCCTTTGCAGCTTCTCCTGGGG - Exonic
1013589708 6:111609770-111609792 CCTCTTAGAAGCCTCTGCTGGGG + Intergenic
1013725983 6:113096574-113096596 TTTCTTTTTATCTTCTCCTGTGG - Intergenic
1016726953 6:147382790-147382812 GCTCCTTGAAGCCTTTCCTGAGG - Exonic
1018066461 6:160127948-160127970 TCTCTTTGCAGCCTCACCCGTGG - Intronic
1018475167 6:164133381-164133403 TGTCTTAGGAGCCTCTCCAGTGG - Intergenic
1019783223 7:2957148-2957170 TTTCTGTGGAGCCTAGCCTGGGG - Intronic
1020046407 7:5044259-5044281 TCTCTCTGAAGCCTGTTCTGAGG + Intronic
1020291765 7:6728168-6728190 TCTCTCTGAAGCCTGTTCTGAGG + Intergenic
1021809911 7:24393009-24393031 TTTCTTATAAGCCTTTCCTTGGG - Intergenic
1022417234 7:30188897-30188919 GTTCCTTGAAGCCCCACCTGAGG + Intergenic
1024879622 7:54070672-54070694 TTCCTTGGAAGCCTCCCCTGTGG - Intergenic
1025093262 7:56080053-56080075 TTTCTTTGTGGCCTCATCTGTGG + Exonic
1025202918 7:56973155-56973177 TTCCTGTGAAGCATCTCCGGTGG + Intergenic
1025669026 7:63603771-63603793 TTCCTGTGAAGCATCTCCGGTGG - Intergenic
1025802265 7:64797545-64797567 TTTCTAGGAAGCCTCCCCTGCGG + Intronic
1026362701 7:69617415-69617437 TTTCCTTGAAAGCTCTCCTCCGG - Intronic
1026726976 7:72877748-72877770 TCTCTCTGAAGCCTGTTCTGAGG + Intergenic
1027007974 7:74712353-74712375 TTTCATTGAAGCCTTTCTTTGGG + Intronic
1027116858 7:75487871-75487893 TCTCTCTGAAGCCTGTTCTGAGG - Intergenic
1027641220 7:80735771-80735793 TTTCTTTGAGAAATCTCCTGTGG - Intergenic
1029720644 7:102362190-102362212 TCTCTCTGAAGCCTGTTCTGAGG + Intergenic
1030200285 7:106896164-106896186 TTCCTTTAACGCCTCTCCTTGGG + Intronic
1032692475 7:134302760-134302782 TTTCTTTTAATCCTTGCCTGAGG - Intronic
1035764402 8:2094227-2094249 TTTCTTTGAAGCCTCTCGGTTGG + Intronic
1036962647 8:13262058-13262080 CTTCTTTGACCCCTCTCTTGGGG + Intronic
1038055922 8:23857521-23857543 TTTCTTTGTAACTTCTCTTGGGG + Intergenic
1042861024 8:73314538-73314560 TTTCTTTTAAGCCTGTGCTCAGG - Intronic
1043086953 8:75847043-75847065 TTTCTTTCAAGCCTTTACTGAGG + Intergenic
1043226036 8:77731619-77731641 TTTTTATGAAGCCTCTCCAAAGG + Intergenic
1043391746 8:79798655-79798677 TTTCTTTCCAGCCTCTGATGTGG - Intergenic
1044185838 8:89251066-89251088 TTTCTTTGATGCCTAGTCTGTGG + Intergenic
1045223337 8:100220299-100220321 TCTCTATGAAACCTCTTCTGAGG + Exonic
1045416882 8:101976329-101976351 TCTCTTTGAATGTTCTCCTGAGG + Intronic
1048860190 8:138719236-138719258 TTTTTTTCATGCCTGTCCTGAGG - Intronic
1051402796 9:16701125-16701147 CATCTTTTAAGCCTCTCCTAGGG - Intronic
1051524737 9:18031338-18031360 TTCCTTTGAAGCCTTGACTGTGG + Intergenic
1052807162 9:33023862-33023884 TAGCTTTGAAGCCTCACCTCCGG + Intronic
1053681087 9:40485910-40485932 TTACCTTGTACCCTCTCCTGGGG - Intergenic
1054282626 9:63139024-63139046 TTACCTTGTACCCTCTCCTGGGG + Intergenic
1054294173 9:63321425-63321447 TTACCTTGTACCCTCTCCTGGGG - Intergenic
1054392195 9:64625914-64625936 TTACCTTGTACCCTCTCCTGGGG - Intergenic
1054426842 9:65131125-65131147 TTACCTTGTACCCTCTCCTGGGG - Intergenic
1054503533 9:65890415-65890437 TTACCTTGTACCCTCTCCTGGGG + Intronic
1054957027 9:70923406-70923428 TTGCTTTGTAGCCTCTCCCATGG + Intronic
1055706599 9:79011811-79011833 TTTGATTGCAGCCTCTCCCGTGG - Intergenic
1057128859 9:92639658-92639680 TTTGTTTGAAGCCTGTCATAAGG - Intronic
1057481724 9:95449840-95449862 TTTCTTTGGACCATATCCTGAGG - Exonic
1060695265 9:125704110-125704132 TCTCTCTGAAGCCTTTCCAGAGG + Intronic
1060741153 9:126098350-126098372 TCTGTTTGCAGCCTCTCCAGGGG + Intergenic
1061990510 9:134156237-134156259 CATCCTGGAAGCCTCTCCTGGGG + Intronic
1062580340 9:137226650-137226672 TCTCTTGGAGGCCTTTCCTGGGG - Intergenic
1185494979 X:547669-547691 TTTTTTTGTAGCCATTCCTGTGG + Intergenic
1186411617 X:9348979-9349001 GTTCATGGAAGCTTCTCCTGGGG + Intergenic
1189132964 X:38519228-38519250 TGTCTTTGTAGCACCTCCTGAGG - Intronic
1190712197 X:53079080-53079102 TTACTTTGAGGCCTGTTCTGTGG + Exonic
1192013867 X:67306686-67306708 TGTCTTTGAAGGCTTTCCAGTGG - Intergenic
1192441524 X:71178175-71178197 ACTCTTTGAAGCCTCTCTTTTGG - Intergenic
1192633059 X:72791766-72791788 TGCCTCTGAAGCCTTTCCTGTGG + Intronic
1192648650 X:72929035-72929057 TGCCTCTGAAGCCTTTCCTGTGG - Intronic
1194575243 X:95605081-95605103 TTTCTCTAATGCTTCTCCTGTGG + Intergenic
1195885773 X:109636003-109636025 TTTCTTGGAAGACACTCCTAAGG - Intronic
1197175172 X:123477983-123478005 TTGCTTTGTAGTTTCTCCTGTGG + Intronic
1200155263 X:153971704-153971726 GCTCTTTGAAGCGGCTCCTGTGG - Exonic