ID: 1103209156

View in Genome Browser
Species Human (GRCh38)
Location 12:119154225-119154247
Sequence GCTCCCTGAAGGGGCGCGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103209156_1103209169 15 Left 1103209156 12:119154225-119154247 CCCCCCGCGCCCCTTCAGGGAGC 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1103209169 12:119154263-119154285 GTGAGAAGGACTCGCAGCAGCGG 0: 1
1: 0
2: 3
3: 9
4: 166
1103209156_1103209170 16 Left 1103209156 12:119154225-119154247 CCCCCCGCGCCCCTTCAGGGAGC 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1103209170 12:119154264-119154286 TGAGAAGGACTCGCAGCAGCGGG 0: 1
1: 0
2: 2
3: 18
4: 174
1103209156_1103209166 1 Left 1103209156 12:119154225-119154247 CCCCCCGCGCCCCTTCAGGGAGC 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1103209166 12:119154249-119154271 GGATCCCAAATACAGTGAGAAGG 0: 1
1: 1
2: 0
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103209156 Original CRISPR GCTCCCTGAAGGGGCGCGGG GGG (reversed) Exonic