ID: 1103210073

View in Genome Browser
Species Human (GRCh38)
Location 12:119159160-119159182
Sequence GGGACTGATGTGCCTCCTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103210073_1103210079 15 Left 1103210073 12:119159160-119159182 CCAGAAGGAGGCACATCAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1103210079 12:119159198-119159220 ACCCAGCGTCCAGGAGGGTCAGG 0: 1
1: 0
2: 3
3: 18
4: 162
1103210073_1103210077 9 Left 1103210073 12:119159160-119159182 CCAGAAGGAGGCACATCAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1103210077 12:119159192-119159214 CACTTAACCCAGCGTCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 73
1103210073_1103210076 6 Left 1103210073 12:119159160-119159182 CCAGAAGGAGGCACATCAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1103210076 12:119159189-119159211 CATCACTTAACCCAGCGTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 91
1103210073_1103210078 10 Left 1103210073 12:119159160-119159182 CCAGAAGGAGGCACATCAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1103210078 12:119159193-119159215 ACTTAACCCAGCGTCCAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103210073 Original CRISPR GGGACTGATGTGCCTCCTTC TGG (reversed) Exonic
902611385 1:17599539-17599561 GCAACTGATGTGGCGCCTTCAGG + Intronic
903295688 1:22341947-22341969 GGGCCTGATGGGCCTCCCCCGGG + Intergenic
903826668 1:26150613-26150635 GGGAATGATGTGCTTCTTTCAGG + Intergenic
904251990 1:29231484-29231506 GGGGATAATATGCCTCCTTCCGG + Intergenic
904494534 1:30879168-30879190 GCCACTGATGGGCCCCCTTCTGG + Intronic
905907336 1:41627753-41627775 GGGACTCCAGGGCCTCCTTCTGG - Intronic
910788697 1:91028400-91028422 GCTACTGATGAGCCTCCTGCTGG + Intergenic
914459595 1:147870880-147870902 GGGAGTGATGTGAAGCCTTCAGG + Intergenic
922236903 1:223728783-223728805 TGGGCTGATGTGCCAGCTTCAGG + Intronic
1063778139 10:9288124-9288146 GGGACTGGGGTGCCTCCATAGGG - Intergenic
1066067374 10:31772182-31772204 GGCACTGATGTGTCTCAATCTGG - Intergenic
1067811229 10:49428817-49428839 GGGACAGATGAGCCTCCTCCTGG + Intergenic
1070593734 10:77818271-77818293 GGGACCTATGTGCCTCACTCGGG + Intronic
1070886493 10:79904665-79904687 GGACCAAATGTGCCTCCTTCTGG + Intergenic
1071822457 10:89292311-89292333 GGCACTGATTTGTCTTCTTCTGG + Intronic
1074015341 10:109528724-109528746 GGGCCTGCTGGGCCTCCTGCTGG - Intergenic
1075043744 10:119129184-119129206 TTGACTGATGTTCCCCCTTCAGG - Intronic
1075707427 10:124510041-124510063 GGGACTGTGGCGCCTCCATCCGG + Intronic
1076449175 10:130544455-130544477 GACACTGATGTCACTCCTTCAGG + Intergenic
1077452851 11:2661398-2661420 GGGACTCCTGTGCCTCATTGGGG + Intronic
1077916385 11:6614488-6614510 GGGACTGAACTGCCAGCTTCAGG + Exonic
1081286160 11:41272459-41272481 GGGACTCAGGTGCCTCAGTCAGG + Intronic
1083210628 11:61182942-61182964 TGGAATGGTGTGGCTCCTTCTGG - Intergenic
1083374492 11:62208618-62208640 GGGACTAAGGTGCCTCCCTGGGG + Intergenic
1083939579 11:65888466-65888488 GGGACTGGCGCGCCGCCTTCAGG + Exonic
1085200213 11:74697229-74697251 GGAAGTGCTGTGCCTCTTTCTGG + Exonic
1087896713 11:103594458-103594480 GCTACTGCTGTGCCTCCTACAGG + Intergenic
1089647889 11:119892167-119892189 GGCTCTGATGTGCCTCCCTCTGG + Intergenic
1090383201 11:126341305-126341327 GTGACTGATGGGCCACCTTCTGG + Intronic
1091605612 12:1949085-1949107 GGCACTGCTGTACCTCATTCAGG - Exonic
1096515028 12:52151041-52151063 GTCACTGATGTGCCTTCTTTGGG + Intergenic
1096553822 12:52391164-52391186 GGGACAGATGTGCCTCCTGGTGG - Intergenic
1099202957 12:79696367-79696389 TGGACTGATGGGCCTCATTTAGG + Intergenic
1100346658 12:93738290-93738312 AGGTCTCATGGGCCTCCTTCAGG - Intronic
1100404610 12:94262650-94262672 GGGTCTGATGTCCCTCCACCAGG + Intronic
1101430884 12:104626071-104626093 GGGACTGTTTAACCTCCTTCAGG + Intronic
1101511578 12:105397848-105397870 GGAACTGATGGGTCTGCTTCTGG - Intergenic
1102762268 12:115398472-115398494 GGGGGTGATCTGGCTCCTTCTGG - Intergenic
1103210073 12:119159160-119159182 GGGACTGATGTGCCTCCTTCTGG - Exonic
1105541103 13:21318241-21318263 GGGACTGAAGTGCAGCCTTTTGG - Intergenic
1105867549 13:24474343-24474365 GGGCCTGCTGTGTCCCCTTCAGG + Intronic
1121248583 14:92482923-92482945 GGTACTGCTGTGCCACCTTTGGG + Intronic
1123819679 15:24015421-24015443 GTAACTGATCTGCTTCCTTCAGG - Intergenic
1126367445 15:47910424-47910446 GGGACTGATCTACCCCCTTATGG + Intergenic
1126694255 15:51312900-51312922 GGGATGGATGGGACTCCTTCAGG + Intronic
1126746174 15:51828796-51828818 TGGACTGACGTGCCTGCTTGAGG - Intergenic
1127257546 15:57304867-57304889 GGGAATTAAGTGCCACCTTCTGG + Intergenic
1134744258 16:16575164-16575186 GGAGCAGAAGTGCCTCCTTCAGG + Intergenic
1135001226 16:18778594-18778616 GGAGCAGAAGTGCCTCCTTCAGG - Intergenic
1138358834 16:56408864-56408886 GGGACTCATGAGACTACTTCAGG + Intronic
1142052027 16:87965201-87965223 GGGCCTGATGGGGCTCATTCCGG - Intronic
1145122943 17:20277113-20277135 GGGACAGATGTGGCCCATTCAGG + Intronic
1146162314 17:30566542-30566564 GGGACTGTTGTCACTCCTTCAGG + Intergenic
1147442342 17:40454791-40454813 GGCTCTGGTGTGCCTCCTGCTGG + Intronic
1148631001 17:49109215-49109237 GGGACTGATTTGCCTACATAAGG - Intergenic
1149531761 17:57401503-57401525 AGGACTGATGAGGCTACTTCTGG - Intronic
1149601784 17:57898189-57898211 GGGACTCACCTGCCTCCTGCTGG + Intronic
1150472767 17:65451173-65451195 GGGATAGATGTGCCTGCCTCTGG + Intergenic
1150704976 17:67478391-67478413 GGGACTGCTGTGTCTCTTTTAGG - Intronic
1152330664 17:79670741-79670763 GGGACTGAAGTGGCTCCTGCTGG - Intergenic
1153988977 18:10378405-10378427 GGGACTGCTGTGTCCCCTCCTGG - Intergenic
1155757589 18:29520492-29520514 TGGATTGATGTGCCTGGTTCTGG - Intergenic
1156491532 18:37499309-37499331 GGCACTGAGGTGCCTCTTTGGGG - Intronic
1158045064 18:53145856-53145878 GGGACTGATGTACCTGCACCTGG + Intronic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1160027394 18:75229589-75229611 GGGACTGAAGCCCCTCCTTGGGG + Intronic
1160210689 18:76875535-76875557 GGGTCTGCAGTGCCCCCTTCTGG - Exonic
1164506379 19:28864655-28864677 GGGAGAGCTGTGCCTCCTTAAGG + Intergenic
1165402763 19:35612507-35612529 AGGACTGTTTTGCCTCTTTCGGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925351470 2:3203881-3203903 TGGTCGGATGTGGCTCCTTCTGG - Intronic
928392518 2:30920401-30920423 GGGGCAGATGTGACTCCCTCTGG + Intronic
934663507 2:96155280-96155302 GGGACTGAAGCCCCTCCTTAAGG + Intergenic
935718752 2:105961054-105961076 GGGCCTCGTGTGCCTCCTCCTGG + Intergenic
946539986 2:220673548-220673570 GTGACTGGCGTGCTTCCTTCTGG - Intergenic
1173941453 20:46914549-46914571 GGCACTGATTCTCCTCCTTCCGG - Intronic
1173941541 20:46915094-46915116 GAGGCTGATGTGGCTCCTTTGGG - Intronic
1178287326 21:31336662-31336684 GGGACTCATGATCCTACTTCAGG + Intronic
1180061020 21:45385135-45385157 GGGCCAGATGTGCGTCCTGCAGG - Intergenic
1182050914 22:27311881-27311903 GGGACAGAGGAGCCTCCTGCAGG + Intergenic
1183154656 22:36065895-36065917 GTGACTGATGTCCCTCCGGCTGG + Intergenic
1185281156 22:49970474-49970496 AGGACTGAGGTGGCTGCTTCAGG - Intergenic
950270379 3:11610080-11610102 TGCACTGATGTGTCTCCTTCAGG + Intronic
953022571 3:39125124-39125146 GGGACTTCTGCACCTCCTTCAGG - Exonic
954134049 3:48573903-48573925 GGCACTGATGAGCCTCAATCTGG + Intronic
954972231 3:54660943-54660965 GTGACTGATGGGCCTCTTTGGGG + Intronic
958883988 3:99705480-99705502 GGGTCTGCTGTCCCTTCTTCTGG - Intronic
960809033 3:121610943-121610965 GGAACTGCTGTACCTCCTACTGG + Intronic
960939820 3:122926283-122926305 GGGACTGCCGTGCCTCCTGCCGG - Intronic
968742668 4:2339388-2339410 GGGACGGTTGTGCCAGCTTCCGG - Intronic
971736448 4:30459521-30459543 TGGAATGATGAGCCTACTTCTGG + Intergenic
980181049 4:129401111-129401133 GGATCTGATGTGGCTCCTTCTGG + Intergenic
981529210 4:145735557-145735579 GGGACTGATAGGGCTTCTTCTGG + Intronic
985555370 5:555456-555478 GGGCCTGATGTGCCCACTGCTGG - Intergenic
989576306 5:42991682-42991704 GGGACGGATTTGGCTCCTCCAGG - Intergenic
990735773 5:58860110-58860132 GGGACTCATGTGGCTCTTCCAGG - Intergenic
992780153 5:80120305-80120327 GGAACAGATATGCCTCCTCCAGG + Intronic
996765605 5:127031436-127031458 GGGACAGATGTGGTTCGTTCTGG - Intergenic
997442077 5:133915807-133915829 AGGACTGTAGTCCCTCCTTCTGG + Intergenic
1002023747 5:176383046-176383068 GGGACTGATGGGCAGCCTTCAGG + Intronic
1003410497 6:5857891-5857913 GGGACTGAAGTGCAGCCTTTTGG + Intergenic
1005708461 6:28480737-28480759 GAGACTGATGTGCTGCCTCCAGG - Intergenic
1007364887 6:41384392-41384414 TGGACTTCTGTACCTCCTTCTGG - Intergenic
1008751314 6:54737046-54737068 GGGACTGCTGGGCCAGCTTCCGG + Intergenic
1011419035 6:87152576-87152598 GGGACAGATGTGCTTGCATCCGG - Intergenic
1012214095 6:96560416-96560438 GGGAATGATCTTCCTGCTTCTGG - Intergenic
1021604112 7:22393423-22393445 GGAAATGATGTTCCTCTTTCTGG + Intergenic
1022359915 7:29647990-29648012 GGGTCAGATGTGCCTGCTGCAGG + Intergenic
1022368723 7:29750656-29750678 GGGTCAGATGTGCCTGCTGCAGG + Intergenic
1022472391 7:30689692-30689714 GGAACTGATGGGTGTCCTTCAGG + Intronic
1025263986 7:57440624-57440646 GGGACAAATGTGGGTCCTTCTGG + Intergenic
1025772834 7:64528849-64528871 TGTGCTGATTTGCCTCCTTCTGG - Intronic
1026982675 7:74535959-74535981 AGGGCTGCTGTTCCTCCTTCTGG + Intronic
1027592358 7:80133583-80133605 GAGACTGAGTTGCCTCCTTATGG - Intergenic
1032388560 7:131540934-131540956 GGGAATGATCTGCTTCCGTCTGG + Intronic
1032714138 7:134489849-134489871 GTGATTGACCTGCCTCCTTCAGG - Intergenic
1033422105 7:141212768-141212790 GGATTGGATGTGCCTCCTTCTGG + Intronic
1034974654 7:155440820-155440842 GGGGCTGAGCTGCCGCCTTCAGG - Intergenic
1035834050 8:2728986-2729008 AGAACTGACGTGGCTCCTTCTGG - Intergenic
1037950698 8:23017298-23017320 GGTAATGATCTTCCTCCTTCAGG - Exonic
1038978744 8:32732483-32732505 TGGACAGATGTGCCTTCATCTGG + Intronic
1040416318 8:47198839-47198861 GGGCCCCATGTGCCCCCTTCAGG - Intergenic
1041732823 8:61079491-61079513 GGGTCTCCTGTGCCTCATTCAGG + Intronic
1049423516 8:142527086-142527108 GGAGCTGATGTTCCTCCCTCCGG + Intronic
1049926123 9:409177-409199 GGTACTGAGATGCGTCCTTCTGG - Intronic
1051591067 9:18777190-18777212 GGGTCTGCAGGGCCTCCTTCGGG - Exonic
1052225699 9:26083083-26083105 GTGACTGAAGTGTCTCCATCTGG + Intergenic
1056266154 9:84898598-84898620 GGGATTGTTGTGGCTCCTTGTGG + Intronic
1056855822 9:90128740-90128762 GGCACTGAGGAGCCTCCTCCAGG - Intergenic
1061968919 9:134033067-134033089 AGGACAGATGTGCCTGCTTGTGG - Exonic
1188103150 X:26115838-26115860 GGGCCTGATAAGCCCCCTTCAGG - Intergenic
1188887564 X:35569117-35569139 GGTGCTGATGTGGCTCCTTCAGG + Intergenic
1190822242 X:53984862-53984884 GGGACTGAGGAGACCCCTTCTGG + Intronic
1191782736 X:64886001-64886023 GGGACTGGTGTTCCTCAATCTGG - Intergenic
1193174177 X:78372704-78372726 TAGTCTGATGTGCTTCCTTCTGG + Intergenic
1193971690 X:88063100-88063122 GGGACTGAGATTCCTCCCTCCGG + Intergenic
1196744355 X:119056210-119056232 GGGCCTGATAAGTCTCCTTCAGG + Intergenic