ID: 1103211730 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:119172067-119172089 |
| Sequence | ATCAATAAACGGATTGTAAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1103211730_1103211733 | -7 | Left | 1103211730 | 12:119172067-119172089 | CCTTTTACAATCCGTTTATTGAT | No data | ||
| Right | 1103211733 | 12:119172083-119172105 | TATTGATACACATGAAAGCAGGG | No data | ||||
| 1103211730_1103211732 | -8 | Left | 1103211730 | 12:119172067-119172089 | CCTTTTACAATCCGTTTATTGAT | No data | ||
| Right | 1103211732 | 12:119172082-119172104 | TTATTGATACACATGAAAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1103211730 | Original CRISPR | ATCAATAAACGGATTGTAAA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||