ID: 1103211730

View in Genome Browser
Species Human (GRCh38)
Location 12:119172067-119172089
Sequence ATCAATAAACGGATTGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103211730_1103211733 -7 Left 1103211730 12:119172067-119172089 CCTTTTACAATCCGTTTATTGAT No data
Right 1103211733 12:119172083-119172105 TATTGATACACATGAAAGCAGGG No data
1103211730_1103211732 -8 Left 1103211730 12:119172067-119172089 CCTTTTACAATCCGTTTATTGAT No data
Right 1103211732 12:119172082-119172104 TTATTGATACACATGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103211730 Original CRISPR ATCAATAAACGGATTGTAAA AGG (reversed) Intergenic
No off target data available for this crispr