ID: 1103211889

View in Genome Browser
Species Human (GRCh38)
Location 12:119173195-119173217
Sequence GAGAGTGACGACTGCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103211889_1103211892 -1 Left 1103211889 12:119173195-119173217 CCTTCCAGGCAGTCGTCACTCTC No data
Right 1103211892 12:119173217-119173239 CCCAAATGTCAGCGTGTTCCTGG No data
1103211889_1103211895 27 Left 1103211889 12:119173195-119173217 CCTTCCAGGCAGTCGTCACTCTC No data
Right 1103211895 12:119173245-119173267 TTTGTTCTGCTGAGAAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103211889 Original CRISPR GAGAGTGACGACTGCCTGGA AGG (reversed) Intergenic
No off target data available for this crispr