ID: 1103212125

View in Genome Browser
Species Human (GRCh38)
Location 12:119174844-119174866
Sequence TCACCCTGCATGCCTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103212125_1103212131 14 Left 1103212125 12:119174844-119174866 CCAGTTTCAGGCATGCAGGGTGA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1103212131 12:119174881-119174903 TGGGCTGTTTTGAGAATTAATGG 0: 1
1: 2
2: 10
3: 82
4: 656
1103212125_1103212127 -5 Left 1103212125 12:119174844-119174866 CCAGTTTCAGGCATGCAGGGTGA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1103212127 12:119174862-119174884 GGTGATCTCACCTACCTCCTGGG 0: 1
1: 0
2: 4
3: 23
4: 184
1103212125_1103212132 17 Left 1103212125 12:119174844-119174866 CCAGTTTCAGGCATGCAGGGTGA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1103212132 12:119174884-119174906 GCTGTTTTGAGAATTAATGGTGG 0: 1
1: 0
2: 1
3: 39
4: 291
1103212125_1103212126 -6 Left 1103212125 12:119174844-119174866 CCAGTTTCAGGCATGCAGGGTGA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1103212126 12:119174861-119174883 GGGTGATCTCACCTACCTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103212125 Original CRISPR TCACCCTGCATGCCTGAAAC TGG (reversed) Intergenic
903851725 1:26311069-26311091 TCACCCTGCAGGTGGGAAACAGG - Intronic
904025607 1:27501512-27501534 TCACCCTCCAAACCTCAAACAGG - Intergenic
904211379 1:28888384-28888406 CCATCCTCCAGGCCTGAAACTGG - Intronic
905270707 1:36785710-36785732 CCACTCTGCAACCCTGAAACAGG - Intergenic
905890354 1:41515065-41515087 TCACTCTGCAGACCAGAAACAGG - Intronic
906256468 1:44354834-44354856 TCACCCCGCATGCATTAACCAGG + Intronic
910432713 1:87174818-87174840 CCACCCTCCATGCCTGAAAGAGG - Intergenic
910440161 1:87243581-87243603 TCCCACTGCCTGCCTGAATCTGG + Intergenic
916354879 1:163893733-163893755 TCACCCTTCTTCCCTGAAGCAGG - Intergenic
916628249 1:166583215-166583237 TCAGCCTGCATGCCAGAATGTGG + Intergenic
920213865 1:204348526-204348548 TCACACAGCATGGCTGAAAATGG + Intronic
920958846 1:210645972-210645994 TCACCCTGCAGTTCTGCAACTGG + Intronic
921339663 1:214122153-214122175 CCACCCTGCAAGCCCCAAACTGG + Intergenic
921344425 1:214167472-214167494 TCACTCTACAAGCCTGAAAAAGG - Intergenic
923596345 1:235363092-235363114 TCAGCCTACATGCCTGGAGCTGG + Intergenic
924870450 1:248038154-248038176 TCCCAGTGGATGCCTGAAACTGG - Intronic
1063128378 10:3155210-3155232 ACACCCGGTATGCCTGAGACAGG + Intronic
1065173840 10:23057858-23057880 TCACCCTTCTCCCCTGAAACAGG - Intergenic
1065263635 10:23952472-23952494 TCACTCTGAATGCTTCAAACAGG + Intronic
1065835423 10:29653322-29653344 ACAGCCTGCATGGCTGAAGCAGG - Intronic
1066093439 10:32049433-32049455 TCACCCTTCATGACTAATACTGG - Intronic
1067189781 10:44059509-44059531 ACACCCTGCATCCCTGACCCTGG - Intergenic
1069933987 10:71902528-71902550 TCACACTGCATGGCTGACAGAGG - Intergenic
1071052966 10:81473574-81473596 TCATCCTACCTGCCTGAATCTGG - Intergenic
1072611395 10:97019625-97019647 TTACCCTCCATGCCTGAGCCAGG + Intronic
1076640602 10:131914039-131914061 TCACCATACCTGCCTGAAAGGGG + Intronic
1076786821 10:132754071-132754093 TCACCCTGCATGGCTGGCATGGG - Intronic
1079745108 11:24116984-24117006 TGACACAGCATGCGTGAAACTGG + Intergenic
1080400927 11:31934789-31934811 TCAGGATGCATGCCTGAAGCTGG - Intronic
1080608162 11:33881744-33881766 GCTTCCTGCATGCCAGAAACTGG - Intronic
1080639447 11:34150169-34150191 CCTGCCTGCCTGCCTGAAACAGG - Intergenic
1080778524 11:35408601-35408623 ATACCCGGCATACCTGAAACTGG - Intronic
1081689712 11:45069632-45069654 TCCTGCTGCTTGCCTGAAACTGG + Intergenic
1083609023 11:63996386-63996408 CCACCCTGGGTCCCTGAAACAGG - Intronic
1084596652 11:70120618-70120640 TCACCCTCCATGCCTCCAACAGG - Intronic
1084664450 11:70569027-70569049 GCATGCTGCATGCCTGAAAACGG - Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1092766946 12:11861512-11861534 TCACCCTTCCTGCCTGCACCAGG + Intronic
1093043281 12:14410803-14410825 ACCCACTGAATGCCTGAAACTGG - Intronic
1094420812 12:30269217-30269239 CCACCCTGCATGTCTGAAATTGG - Intergenic
1097633486 12:62093253-62093275 TCACAATGCATTCCTGAAAATGG - Intronic
1100099234 12:91082231-91082253 TCACCCTTCTTCCCTGAAGCAGG - Intergenic
1100301269 12:93310050-93310072 TCCCACTTCATGACTGAAACCGG - Intergenic
1101919695 12:108922460-108922482 TCTGCCAGCATGCATGAAACTGG + Intronic
1102487586 12:113268672-113268694 TCATCCTGCATACCTGGAACGGG - Intronic
1103212125 12:119174844-119174866 TCACCCTGCATGCCTGAAACTGG - Intergenic
1103470565 12:121176950-121176972 ACACCCTGCACGGCTGAAGCAGG + Intronic
1104165724 12:126227687-126227709 TCACACTGCATAGCTTAAACTGG - Intergenic
1109803596 13:67407094-67407116 TCACACTGCATGCTTGTCACAGG + Intergenic
1113327131 13:109293191-109293213 TCCCCTTGCTTGCCTGAAAGAGG - Intergenic
1115395614 14:32905180-32905202 TCAGCCTGCAGGCCTGGAAGAGG - Intergenic
1119136176 14:72222588-72222610 TCACCCTGCATTTCTGCAATTGG - Intronic
1119422040 14:74512982-74513004 TCATCTGGCATCCCTGAAACAGG - Intronic
1121049718 14:90812500-90812522 TAACCCTGCACGTCTGAAGCCGG + Intronic
1121714135 14:96060666-96060688 CCATGCTGCATGCCTGAAAGAGG + Intronic
1123582542 15:21729948-21729970 TCACTCTCCATGCAGGAAACAGG - Intergenic
1123619192 15:22172544-22172566 TCACTCTCCATGCAGGAAACAGG - Intergenic
1124957667 15:34370279-34370301 TCATCCTGGATGACTGACACCGG - Intergenic
1125281579 15:38047530-38047552 TCATCCTACATGGCTGAAGCAGG + Intergenic
1125797239 15:42411757-42411779 TCACCATGTATGCCTGAACCAGG + Exonic
1127197531 15:56605669-56605691 ACATCCTACATGCCTGGAACAGG + Intergenic
1129191675 15:73941308-73941330 TCACCCTGGCTGCCTGGACCAGG + Intronic
1130885173 15:88086859-88086881 CCACCCTCCATGCCTGAAGGAGG + Intronic
1131219994 15:90575490-90575512 TCACACTGCATACCTTACACTGG - Intronic
1131250875 15:90829253-90829275 TCACCCAGCATGTCGGCAACAGG - Intergenic
1131330781 15:91497322-91497344 TGACCCTGCATGCTGGATACTGG - Intergenic
1132830086 16:1923734-1923756 ACACCCTTCATCCCTGAGACTGG + Intergenic
1133602234 16:7350746-7350768 TTACCCCACATCCCTGAAACGGG - Intronic
1135138849 16:19904776-19904798 TCACCCTGCTCCCCTGAAGCCGG - Intergenic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1138473460 16:57256832-57256854 TCACCCTGCAAGCCTGAAGCTGG - Exonic
1140820942 16:78662531-78662553 TCATCCTGCATCCTTGCAACTGG - Intronic
1140907269 16:79419509-79419531 TAAGCCTGGAAGCCTGAAACAGG - Intergenic
1142259994 16:89038216-89038238 ACCCCCTGCATGCCTGACACTGG - Intergenic
1142279506 16:89140383-89140405 TCAGCCTCCAAGCCTGGAACAGG - Intronic
1147639677 17:41988322-41988344 TCACCATGCATGGTTGAAAATGG - Intronic
1149411902 17:56417291-56417313 TCACATTGCATGCCTGTATCAGG + Intronic
1152242829 17:79169187-79169209 CCCCCCTGCATGTCTGAATCAGG - Intronic
1152696765 17:81801498-81801520 TCACCCTGCCTGCCTTCAGCAGG - Intergenic
1156983462 18:43321132-43321154 TCACCGTGGAAGCCTGAAAAAGG + Intergenic
1157472793 18:48002954-48002976 CCACCCAGGAGGCCTGAAACTGG - Intergenic
1158814771 18:61082593-61082615 TCAGCCTACATGTCTGAGACAGG - Intergenic
1158985394 18:62810427-62810449 TCCCAGTGGATGCCTGAAACTGG + Intronic
1160817403 19:1042485-1042507 ACAGCCTGGATGCCTGGAACGGG - Intronic
1164956094 19:32386641-32386663 TCAAGCTGCATGCCTTAAAGCGG + Exonic
1165179272 19:33953890-33953912 TCTCCCTGAAAGACTGAAACTGG + Intergenic
1168573298 19:57488087-57488109 TCACACTGCGTGTCAGAAACGGG - Intronic
1168574715 19:57500217-57500239 TCACACTGCGTGTCAGAAACGGG - Intronic
926715717 2:15922017-15922039 TCACCCTGCATGGCTGGAGCAGG + Intergenic
926754731 2:16225732-16225754 TCACCCTGCCTGCCAGAAGAGGG + Intergenic
927197332 2:20557756-20557778 TCAGCCTGCATTCCTGAACATGG + Intergenic
932822698 2:74915100-74915122 TCACCCGGTGGGCCTGAAACAGG + Intergenic
935400799 2:102658039-102658061 TCACACTGCATGACTCCAACAGG + Intronic
937874262 2:126809451-126809473 TGGCCCTGCATCCCTGAGACAGG - Intergenic
941312379 2:163950290-163950312 TCACCCTGGAAGCTTGAAAGAGG + Intergenic
945885693 2:215373400-215373422 TCTCCCTTCAGGCCTGGAACCGG - Exonic
946472781 2:219978220-219978242 TCAGCCTGCATCCCTGAGAGAGG - Intergenic
947029726 2:225780326-225780348 TCACTCCTCATTCCTGAAACGGG - Intergenic
1170926413 20:20728649-20728671 GCACCAGGCATGCTTGAAACAGG - Intergenic
1171960470 20:31490185-31490207 CCACGTTTCATGCCTGAAACTGG - Intergenic
1175037609 20:56015085-56015107 TCACCCTGGATGCTTGATGCTGG - Intergenic
1175308732 20:57996195-57996217 TCACACTGGATGCATGGAACTGG + Intergenic
1175383815 20:58581483-58581505 TCACCTTGCAAGTCAGAAACAGG + Intergenic
1175709616 20:61208921-61208943 TCACCCAGCAAGCCTGGAACTGG + Intergenic
1175945879 20:62558524-62558546 GCACCCAGCACTCCTGAAACAGG - Intronic
1175960839 20:62635553-62635575 TCAGCCTGCGTGGATGAAACCGG + Intergenic
1177559368 21:22730231-22730253 TCACACTGCCTGCCTAACACCGG - Intergenic
1181400094 22:22646024-22646046 TTGCACTGCATGCCTGGAACTGG - Intronic
1182570156 22:31231197-31231219 TCACCCTGCCTGCCACACACTGG + Intronic
1184988562 22:48152753-48152775 GGACCCTGCAGGCCTGAAACTGG + Intergenic
952421012 3:33131514-33131536 TCGCCCTGCATATCAGAAACTGG + Intronic
960045670 3:113195139-113195161 TCTCCCTGCAAGCCTGAACGCGG - Intergenic
960507661 3:118513102-118513124 TCACCCTTTTTTCCTGAAACAGG + Intergenic
963086022 3:141437377-141437399 TTTCCCTGCATGCCTGATCCTGG + Intronic
963795507 3:149627321-149627343 ACACCCTACATGGCTGAAAATGG - Intronic
964451381 3:156816560-156816582 TCACCCCGCCTGCCTGGAGCCGG - Intergenic
966712259 3:182981948-182981970 TCATGCAGCAAGCCTGAAACTGG + Intronic
976967156 4:91057196-91057218 CCACCCTCCATTCCTGAGACAGG - Intronic
978637019 4:110821784-110821806 TCACCCAGCTTGTCTGAATCAGG + Intergenic
979447664 4:120833753-120833775 CCCCCGTGAATGCCTGAAACTGG - Intronic
982100769 4:151965459-151965481 CCACCCTTCATGTCTGAAGCTGG + Intergenic
982115296 4:152093967-152093989 TCCCCCTGCATGACTGAATCAGG - Intergenic
990351976 5:54927650-54927672 ACAGCCTGCATGCCTGGTACTGG - Intergenic
990516430 5:56534956-56534978 TCACCCTGCCTGCCTGAACCTGG + Intronic
995612238 5:113923136-113923158 TCACCCTTTATACCTGAAAGCGG - Intergenic
995697985 5:114901084-114901106 TCACCCTGAGTGCCTATAACTGG - Intergenic
997584403 5:135035812-135035834 CCACCCTGCATGCCCGACCCTGG - Intronic
998943894 5:147316356-147316378 TCACCCAGATTGTCTGAAACAGG + Intronic
999306306 5:150521688-150521710 TCAACCTGGACGCCTGGAACCGG + Exonic
1000652967 5:163840197-163840219 TCACTCTGCATAACAGAAACTGG - Intergenic
1002147514 5:177196881-177196903 TCTCAGTGGATGCCTGAAACTGG + Intronic
1002924454 6:1596862-1596884 GCATCCAGCATGTCTGAAACAGG + Intergenic
1003751044 6:9056661-9056683 TCTCCCTGAATGCCTCAGACTGG + Intergenic
1005340700 6:24841156-24841178 TCACCCTAGATGCCTGGAATGGG + Intronic
1005917564 6:30366529-30366551 TTAGCCTGCTTTCCTGAAACTGG + Intergenic
1007872225 6:45053566-45053588 TCACCCTTCATCCCTAAAGCAGG + Intronic
1007878273 6:45131907-45131929 ACTCCATGGATGCCTGAAACTGG + Intronic
1009028203 6:58025143-58025165 GCACCCTGCAAAACTGAAACCGG - Intergenic
1013033628 6:106360380-106360402 TCACCCTGCCAGCCTGTCACAGG + Intergenic
1014635296 6:123838827-123838849 TCACCCTGTATGCTAGAAAAAGG + Intronic
1016107841 6:140184933-140184955 TAACCCTGGGTGCCTGGAACTGG - Intergenic
1018258909 6:161950065-161950087 TCACACTGCATTCCAGACACTGG - Intronic
1018619037 6:165713031-165713053 TCGCACTGGATGACTGAAACAGG - Intronic
1020345231 7:7154968-7154990 TCACACTGCTTCCCTGAGACTGG - Intergenic
1021143372 7:17054630-17054652 TCATCCTGCATACCTGAGAGAGG + Intergenic
1023674701 7:42617389-42617411 TCACCCAGTGAGCCTGAAACTGG + Intergenic
1024466585 7:49717703-49717725 TCACCCACCATCCCTGAAAAAGG - Intergenic
1024991753 7:55240202-55240224 TCCTGCTGCAAGCCTGAAACAGG + Intronic
1029265194 7:99333385-99333407 TCACCTGTCATGCCTGGAACAGG + Exonic
1030374342 7:108737846-108737868 TGACCCAGCATGAGTGAAACTGG - Intergenic
1032489912 7:132316834-132316856 TCACTCTGCATTGATGAAACTGG - Intronic
1035240552 7:157526519-157526541 CCACCCTGTATTCCAGAAACAGG + Intergenic
1035484840 7:159214879-159214901 TTACCCTCCATGCCTCAAGCTGG + Intergenic
1040636500 8:49280458-49280480 TCACCCTTCTTCCCTGAAGCAGG + Intergenic
1041449243 8:57989776-57989798 TGACCCTGCATGCCTCACAGAGG + Intergenic
1041740747 8:61153843-61153865 CCACCTGGCAGGCCTGAAACTGG + Intronic
1042814292 8:72861628-72861650 TCACCCAGCCTGCCTGCAGCAGG + Intronic
1044626728 8:94241394-94241416 TCTACCTGCATGCTGGAAACAGG + Intergenic
1049246579 8:141565965-141565987 TCACCCAGCATGGCTGGAGCAGG - Intergenic
1049381240 8:142317203-142317225 TCACACTGCACGCGTGAAGCGGG + Intronic
1054755945 9:68957803-68957825 TCACCCTTCTTCCCTGAAGCAGG - Intronic
1055429949 9:76233238-76233260 ACAGCCAGCATGCCAGAAACTGG - Intronic
1058968811 9:110061356-110061378 TCACAATGCATGCATGAAAATGG - Intronic
1059421780 9:114196717-114196739 TCCCCCAGCATGGCTGAAATGGG - Intronic
1062443207 9:136582735-136582757 GCACCGTGGAAGCCTGAAACGGG + Intergenic
1186513714 X:10150307-10150329 TCACTCTGCATGCATGACCCTGG + Intergenic
1190331335 X:49237245-49237267 TCACCATGCAGGCCTGAGCCAGG - Exonic
1196199288 X:112867309-112867331 TCACACTGCCTGCCTGATAAAGG - Intergenic
1196487041 X:116224042-116224064 CCACCCTGCATCCCTGAAAGAGG + Intergenic
1198333400 X:135643331-135643353 GCAGCCTGCATGCCAGAAGCTGG + Intergenic
1198848221 X:140936572-140936594 TCACCCTGTTTGCCAGAAGCTGG - Intergenic
1199654394 X:149980426-149980448 TCACCTCCCATGCCAGAAACTGG - Intergenic