ID: 1103214994

View in Genome Browser
Species Human (GRCh38)
Location 12:119195143-119195165
Sequence ACTGTATCTGGATGGGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103214987_1103214994 14 Left 1103214987 12:119195106-119195128 CCAACCAGGTGGCACAGACAACC 0: 1
1: 3
2: 3
3: 18
4: 269
Right 1103214994 12:119195143-119195165 ACTGTATCTGGATGGGCCAAAGG 0: 1
1: 1
2: 2
3: 16
4: 125
1103214986_1103214994 15 Left 1103214986 12:119195105-119195127 CCCAACCAGGTGGCACAGACAAC 0: 1
1: 3
2: 1
3: 13
4: 113
Right 1103214994 12:119195143-119195165 ACTGTATCTGGATGGGCCAAAGG 0: 1
1: 1
2: 2
3: 16
4: 125
1103214988_1103214994 10 Left 1103214988 12:119195110-119195132 CCAGGTGGCACAGACAACCAAAA 0: 4
1: 0
2: 0
3: 19
4: 199
Right 1103214994 12:119195143-119195165 ACTGTATCTGGATGGGCCAAAGG 0: 1
1: 1
2: 2
3: 16
4: 125
1103214985_1103214994 16 Left 1103214985 12:119195104-119195126 CCCCAACCAGGTGGCACAGACAA 0: 1
1: 2
2: 1
3: 14
4: 179
Right 1103214994 12:119195143-119195165 ACTGTATCTGGATGGGCCAAAGG 0: 1
1: 1
2: 2
3: 16
4: 125
1103214990_1103214994 -7 Left 1103214990 12:119195127-119195149 CCAAAAAGGTCACACAACTGTAT 0: 1
1: 3
2: 2
3: 24
4: 218
Right 1103214994 12:119195143-119195165 ACTGTATCTGGATGGGCCAAAGG 0: 1
1: 1
2: 2
3: 16
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103214994 Original CRISPR ACTGTATCTGGATGGGCCAA AGG Intronic
900736837 1:4304463-4304485 ACTCTCACTGGATGGGCCACAGG - Intergenic
901107989 1:6772379-6772401 TCTCTATCTGGAAGGGCAAAGGG - Intergenic
902332977 1:15739558-15739580 TCTGGACCTGGGTGGGCCAAGGG - Exonic
903236280 1:21952738-21952760 ACTGCTTCTGGCTGGGCCCAGGG - Intergenic
903277899 1:22233272-22233294 GCTGTGTCTGCATTGGCCAATGG + Intergenic
903384561 1:22917955-22917977 GTTGTGTCTGGATGGGCCAGTGG + Intergenic
905697798 1:39988296-39988318 AGTGGATCTGGAGGGGCAAATGG + Intergenic
905974668 1:42165701-42165723 ACTGTATCTGCAGGGGCAAGGGG - Intergenic
917014410 1:170513156-170513178 AATTTATCTGGATGGGCAAATGG - Intergenic
917213995 1:172659265-172659287 ACTGTGCCTGGAGGGGCCCAGGG - Exonic
918538676 1:185603771-185603793 ACTGCATCTAGATGGGGCCATGG + Intergenic
918636683 1:186783025-186783047 ATTGTATCAGGATGTGGCAATGG - Intergenic
920964961 1:210693938-210693960 ACTGCCTCTGGAAGGGCTAAGGG - Intronic
1065253714 10:23843555-23843577 AGTGGATCTGGAGGGACCAATGG - Intronic
1065879675 10:30027862-30027884 ACTGTTGCTGGATGGGCTGAGGG + Exonic
1068551010 10:58408068-58408090 ACTGTAGCAGGAGGGGTCAAGGG + Intergenic
1073506948 10:104003908-104003930 TCTGTGACTGTATGGGCCAATGG - Intronic
1074828734 10:117233193-117233215 ACTGTAGCTGGGTGGGGAAAGGG + Intergenic
1078086895 11:8239309-8239331 ACTGTCTCTGGGTGGACCACAGG + Intronic
1081476428 11:43437126-43437148 TCTTTATCTGGATGTGCCATAGG + Intronic
1082722142 11:56691313-56691335 ACTGGATCAGAATGGGCCAAGGG - Intergenic
1085341160 11:75732441-75732463 AGTGGATCTGGAGGGGTCAACGG + Intronic
1085466864 11:76730003-76730025 AGTGGATCTGGACGGGCAAAGGG + Intergenic
1099040397 12:77646128-77646150 ACAGCATCTGAATGGGCCAGAGG + Intergenic
1102506509 12:113387728-113387750 ATTGTACCTGGATGGGGAAAAGG - Exonic
1103214994 12:119195143-119195165 ACTGTATCTGGATGGGCCAAAGG + Intronic
1104258699 12:127163027-127163049 ACTCTCCCTGGATGGGCCAATGG + Intergenic
1105824850 13:24113181-24113203 ACTATATCTGCACGTGCCAAAGG + Intronic
1107585102 13:41838218-41838240 ACTGTATCTGGATTTCTCAAGGG - Intronic
1108436148 13:50403422-50403444 CCTGTCTCTGGATGCTCCAAGGG - Intronic
1115304813 14:31922857-31922879 AATGGACCTGGATGGGCAAAGGG + Intergenic
1115568628 14:34646942-34646964 ACTGCCTCAGGATGGGCCACAGG - Intergenic
1118771808 14:68947316-68947338 TTTGTGTGTGGATGGGCCAAGGG - Intronic
1121843024 14:97150451-97150473 ACAGTATCTGGCTGGCCCAAGGG - Intergenic
1123100401 14:105793801-105793823 ACTGTTACTGGGTGGGGCAAAGG + Intergenic
1124144130 15:27105876-27105898 AGTGTATATGGATGGACAAATGG + Intronic
1124830893 15:33148400-33148422 AGTGGATCTGGAGGAGCCAATGG - Intronic
1125114050 15:36067691-36067713 ACTTTTTCTGGGTGGGCCCATGG - Intergenic
1128664779 15:69530167-69530189 ACAGTCTCAGGAAGGGCCAACGG - Intergenic
1131359031 15:91772837-91772859 ACTGGATTTCGAGGGGCCAAGGG - Intergenic
1133100984 16:3479635-3479657 ACTGTCATTGGACGGGCCAAGGG + Intronic
1133947068 16:10357441-10357463 CCTTTATCTGAATGGGCCATAGG + Intronic
1135490976 16:22909172-22909194 ACAAAATCTTGATGGGCCAAGGG - Intronic
1141545546 16:84765663-84765685 ACTGTCTGTGGATGGGCCAATGG - Intronic
1144207732 17:12990882-12990904 ACAGTGTCTGGAGGAGCCAAAGG + Exonic
1150703850 17:67470316-67470338 TCTGTATCTTGATGGGGCAGTGG - Intronic
1150817228 17:68401926-68401948 ACTGTATCAGGATGGTCCTCAGG + Intronic
1153535648 18:6098845-6098867 ACTGTGTCTGGGTGGGCCGGGGG + Intronic
1155071669 18:22322182-22322204 ACGGTAAATGGATGGGCCAGAGG + Intergenic
1155689348 18:28598968-28598990 ACTGTATCTGTATGTGTCAGAGG - Intergenic
1156625086 18:38899236-38899258 ACTGTCTCTGGAATGGGCAAAGG + Intergenic
1159865712 18:73702534-73702556 CCTGTAACTGGAGGGGCCAGAGG + Intergenic
1161269799 19:3383540-3383562 TCTGTAGCTGGATGGGGCTATGG + Intronic
1163775278 19:19213674-19213696 TGTGTATCTGGAGGGGCCAAGGG + Intronic
1163795882 19:19337812-19337834 CCTATATCTGGGGGGGCCAAAGG - Intronic
1167898714 19:52601992-52602014 CCTGTAATTGTATGGGCCAAAGG + Intronic
1168551922 19:57303124-57303146 ACAGTAGCTGTATGGGCCACTGG + Intergenic
925280591 2:2681977-2681999 ACTGGTTCTGGATGGACCCACGG + Intergenic
925437753 2:3855383-3855405 ACTGTCTCTGGAAGTGCCGAGGG + Intergenic
927240245 2:20914657-20914679 ACTGTTCCTGGATGTGCCAGTGG + Intergenic
927475653 2:23412485-23412507 AGTGCATCTAAATGGGCCAATGG + Intronic
931319042 2:61158395-61158417 ACTGGAGCTGGATAGGGCAAGGG + Intronic
931632745 2:64316020-64316042 ACAGCATCAGGATGGGCCTAAGG - Intergenic
936830909 2:116645236-116645258 ACTGTACTTGGATGTGCTAATGG - Intergenic
937427476 2:121812189-121812211 CCTTTGTCTGGATGGGACAAAGG + Intergenic
942004013 2:171679691-171679713 AGTGCATCTGGAGGGGCAAAGGG - Intergenic
942032119 2:171972932-171972954 ACTGAATCTGGGCAGGCCAAAGG - Intronic
945876611 2:215284537-215284559 ACTGTATTTCCATGGGCAAATGG + Intergenic
1170005205 20:11661033-11661055 AATGTATCTGGAAGAGCAAAGGG - Intergenic
1171725506 20:28617040-28617062 AATGTAACTGGATGGGCCTGTGG + Intergenic
1171752563 20:29066045-29066067 AATGTAACTGGATGGGCCCATGG - Intergenic
1171789708 20:29511534-29511556 AATGTAACTGGATGGGCCCATGG + Intergenic
1175664229 20:60844452-60844474 AATTTATCTGGACTGGCCAAGGG - Intergenic
1178288929 21:31349932-31349954 ACTGTCTCTAAATGGGCGAATGG + Intronic
1179578887 21:42325691-42325713 CCTGTATGTGGATGGTCCATGGG - Intergenic
1180390395 22:12276643-12276665 AATGTAACTGGATGGGCCCATGG + Intergenic
1180409346 22:12588114-12588136 AATGTAACTGGATGGGCCCATGG - Intergenic
1184066610 22:42125155-42125177 ATTGTCTCTGGAGGGGCCCAAGG + Intergenic
1184069078 22:42137307-42137329 ATTGTCTCTGGAGGGGCCCAAGG + Intergenic
952576076 3:34775694-34775716 AAGGCATCTGCATGGGCCAAGGG + Intergenic
955719473 3:61866261-61866283 TCTGTATCAGGATGGGAAAAGGG - Intronic
956199240 3:66689413-66689435 AGTGGATCTGGAGGGGCAAAAGG - Intergenic
959740804 3:109717254-109717276 TCTATATCTGGATGGTTCAATGG - Intergenic
960036312 3:113105996-113106018 AGTGTATCTGGAGGGGGCCAGGG - Intergenic
960311351 3:116120205-116120227 AAGGTATCTTGATGGACCAAAGG + Intronic
961055806 3:123787909-123787931 ACTGTGCCTGTGTGGGCCAAGGG + Intronic
962206639 3:133440378-133440400 ACTGTATCTGGATGTGCCTGGGG + Intronic
962297628 3:134206177-134206199 AGAGTATCTGGATGTCCCAAAGG - Intronic
963226916 3:142871950-142871972 AGTGGATCTGGAGGGGCAAATGG - Intronic
964628504 3:158782989-158783011 ACAAAATCTGCATGGGCCAAAGG + Intronic
968054423 3:195680672-195680694 ACAGTAGCCAGATGGGCCAAGGG + Intergenic
968101467 3:195968486-195968508 ACAGTAGCCAGATGGGCCAAGGG - Intergenic
969843283 4:9899666-9899688 GGTGTATCTGTTTGGGCCAAAGG + Intronic
972275381 4:37552446-37552468 ACTGTAGCAGGATGAGCCACAGG - Intronic
978830478 4:113078247-113078269 ACTGTAAATGGATGGCCCAGTGG + Intronic
979541403 4:121887606-121887628 ACTGTATTTGTTTGGACCAAGGG + Intronic
983035261 4:162857093-162857115 TCTGTTTTTGGATGTGCCAAAGG - Intergenic
985435064 4:189920746-189920768 AATGTAACTGAATGGGCCCATGG - Intergenic
985501488 5:250468-250490 ACAGTAGCCAGATGGGCCAAGGG + Intronic
986509422 5:8488354-8488376 AATATATTTGCATGGGCCAAGGG + Intergenic
987794702 5:22611844-22611866 AGTGGATCTGGAGGGGCAAATGG + Intronic
987974678 5:24998248-24998270 AATGTATGTGGAGGGGCAAAAGG - Intergenic
991155527 5:63430192-63430214 ACTGATTCTGAAAGGGCCAAGGG + Intergenic
994782250 5:104105164-104105186 ACTGGATGTGGCTGGGCCATGGG + Intergenic
999827136 5:155284501-155284523 ACTGTATCTGTATTGGGAAAAGG + Intergenic
1001475442 5:172047375-172047397 ACTCTCTCAGGATAGGCCAAGGG + Intronic
1003366973 6:5484167-5484189 ATTATTTCTGGATGGGCCAAGGG + Intronic
1006328887 6:33375005-33375027 AATGAACCTGTATGGGCCAAAGG - Intergenic
1007333949 6:41137865-41137887 AATGTGTCTGGAGTGGCCAAGGG - Intergenic
1009636483 6:66271728-66271750 ACGCTATCTGGATGGGCTGATGG - Intergenic
1010221060 6:73449579-73449601 ACTGTATATGGCGGGTCCAAAGG - Intronic
1013519946 6:110923859-110923881 ACTGGATCTGGATGGGCCAAAGG + Intergenic
1013814478 6:114081524-114081546 ACTCTCTCTGGATGGAGCAACGG + Intronic
1014611026 6:123546627-123546649 ACTGCATCTGGAAGGGGCACTGG - Intronic
1015675070 6:135736834-135736856 CCTCTATCAGGATGGGCCTATGG - Intergenic
1016731682 6:147434161-147434183 ACTATATCAGGATGGGCTGAAGG + Intergenic
1021603380 7:22386880-22386902 ACTATATCTGGAAGGGAAAATGG + Intergenic
1029275284 7:99400322-99400344 ACTGGATCTGGACGGGCCAAAGG - Exonic
1031883340 7:127220943-127220965 ATTATACCTGCATGGGCCAAGGG - Intronic
1032268344 7:130383567-130383589 ACTGCTTCTGGATGGGCAAAGGG - Intronic
1034850355 7:154487594-154487616 ACTGTAGCTGTTTGGCCCAAGGG + Intronic
1034883987 7:154783670-154783692 ACTGTCTCTCGAGGGGACAAAGG - Intronic
1041462440 8:58126288-58126310 AATGTCTCTGAATGGGCAAATGG - Intronic
1042033155 8:64499480-64499502 ACTAGGTCTGGATGGGCCTAGGG - Intergenic
1047006893 8:120630128-120630150 ACTGGATCTGAAGGGGCAAAGGG - Intronic
1047234299 8:123025752-123025774 ACTGCATCTGGAAGGGAGAATGG + Intronic
1048675837 8:136778807-136778829 ACAGGATCTGGATGGGGGAAAGG + Intergenic
1052852851 9:33388272-33388294 TCTGTTTCTGGCTCGGCCAACGG - Intronic
1053724114 9:40978830-40978852 AATGTAAATGGATGGGCCCATGG - Intergenic
1055955897 9:81773235-81773257 AGTGGATCTGGAGGGGCAAAAGG + Intergenic
1059064570 9:111069587-111069609 AGTGTTTCTTGATGGGCCACTGG - Intergenic
1059884267 9:118728195-118728217 ACTCAATCTTGATGGGCTAAAGG - Intergenic
1203451025 Un_GL000219v1:116940-116962 AATGTAACTGGATGGGCCCATGG + Intergenic
1186651470 X:11565811-11565833 ACTGTCGGTGGAAGGGCCAAAGG + Intronic
1186846670 X:13537759-13537781 ACTGTAGCTATATGTGCCAAAGG - Intergenic
1186890322 X:13953474-13953496 ACTGTGCCCGGCTGGGCCAATGG - Intergenic
1187652278 X:21421944-21421966 CCTGCATCTGTATGGGGCAATGG + Intronic
1187941641 X:24388331-24388353 ACTGGATCTGGAGGGACAAATGG - Intergenic
1192440268 X:71169200-71169222 ACTCTATCTGGATGAGGAAAAGG - Intronic
1192586691 X:72324701-72324723 ACTGTATCTGGATGCTCCAGAGG - Intergenic
1195940636 X:110164822-110164844 ACTCTACCTACATGGGCCAAAGG + Intronic
1196079144 X:111612552-111612574 ACTGTGTCAGGATGGGGCAAAGG - Intergenic
1197004220 X:121475921-121475943 AATGGATCTGCATGGGCAAAGGG + Intergenic
1197129079 X:122983224-122983246 ACTGTATCTGGAAGGGAGAATGG - Intergenic
1197201691 X:123754096-123754118 AATGTTTCTGTATGGGCCACTGG + Intergenic