ID: 1103218504

View in Genome Browser
Species Human (GRCh38)
Location 12:119223235-119223257
Sequence GATCCCTAAACACAAACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103218504 Original CRISPR GATCCCTAAACACAAACCCA AGG Intergenic
900530644 1:3151326-3151348 GTTCCCTAATCCCTAACCCAAGG - Intronic
901693361 1:10988868-10988890 CATCCCAAAACGGAAACCCAGGG + Intergenic
904216970 1:28928860-28928882 GTTCCTTAGAAACAAACCCAAGG - Intronic
908831972 1:68188383-68188405 GCTCCCTAAACACAAAGCTGTGG + Intronic
909994438 1:82261330-82261352 GATCCCTAACCCCCAAGCCACGG - Intergenic
910648818 1:89542060-89542082 GAAACTTGAACACAAACCCAAGG + Intronic
912689497 1:111793918-111793940 TATCCCTACCCACAAAGCCAGGG - Intronic
912969241 1:114265050-114265072 GATCCTGAAATCCAAACCCATGG - Intergenic
916411038 1:164547229-164547251 GAGTCCTAGACACAAACACAAGG - Intergenic
918848881 1:189657212-189657234 GATCCCTAAATTCAACCTCAGGG - Intergenic
920919880 1:210289858-210289880 TATACCTATACACATACCCAGGG + Intergenic
921139733 1:212295776-212295798 GTTGCCTAAAGACTAACCCACGG - Intronic
1063720340 10:8574192-8574214 GATCCCTAAACACCATCTCCAGG - Intergenic
1063778903 10:9298163-9298185 GATCACTTATCACAAACCCAAGG + Intergenic
1063845480 10:10122861-10122883 GAGGCCTCAGCACAAACCCAGGG - Intergenic
1066713020 10:38256288-38256310 GATCTCTAAACAGAGACCCAGGG - Intergenic
1067155318 10:43776558-43776580 GATCCCTAAACCCAGAGCCATGG + Intergenic
1067943667 10:50677287-50677309 CCTCCCTAAACACAGACTCAGGG - Intergenic
1067961535 10:50857645-50857667 GTTCCCCAAACACAAAGGCAGGG - Intronic
1068554167 10:58439593-58439615 TATTCCTAAATACAAACCCTGGG - Intergenic
1070865153 10:79704154-79704176 CCTCCCTAAACACAGACTCAGGG - Intronic
1070878944 10:79842285-79842307 CCTCCCTAAACACAGACTCAGGG - Intronic
1071632049 10:87226375-87226397 CCTCCCTAAACACAGACTCAGGG - Intronic
1071645502 10:87358594-87358616 CCTCCCTAAACACAGACTCAGGG - Intronic
1074234043 10:111566864-111566886 GAGGCTTAAACACATACCCATGG + Intergenic
1075234349 10:120712919-120712941 GATTCCTAGACTCTAACCCATGG - Intergenic
1080261121 11:30350758-30350780 GATGCCTAAACACTGACCCTGGG - Intergenic
1081026930 11:38026559-38026581 GGTCCCAAAACACAAGGCCAAGG - Intergenic
1081894394 11:46572351-46572373 CATCTCTAGACATAAACCCAGGG + Intronic
1086574507 11:88323608-88323630 GATCCCTATACACCAACAAAAGG + Intronic
1088583072 11:111334200-111334222 GCACCCTATACACACACCCAAGG + Intergenic
1092663505 12:10766602-10766624 GATCCTAAAACACAAAAACAGGG - Intergenic
1093735812 12:22618963-22618985 GATCACTAAATATAAACCCGGGG - Intergenic
1094240047 12:28212036-28212058 GAGCTCAAAACACAAATCCATGG + Intronic
1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG + Intronic
1098676582 12:73296432-73296454 TATTGCTAAACACAAAACCAGGG + Intergenic
1103218504 12:119223235-119223257 GATCCCTAAACACAAACCCAAGG + Intergenic
1104874502 12:132024630-132024652 GAGCCCTAAACAAAAACACAGGG - Intronic
1106670291 13:31897933-31897955 GAGCCCTAAATGCAAGCCCAAGG - Intergenic
1109013551 13:56979786-56979808 GAGCTCAAAACACAAATCCATGG - Intergenic
1111684156 13:91481531-91481553 CCTCCCTTAACCCAAACCCATGG - Intronic
1111966119 13:94863854-94863876 GAACACTGAAAACAAACCCACGG - Intergenic
1115533903 14:34354523-34354545 GAGCTCAAAACACAAATCCATGG + Intronic
1116483411 14:45418368-45418390 GAGCTCAAAACACAAATCCATGG - Intergenic
1116547228 14:46183560-46183582 GTTCTCTAAACATAAACCCGAGG + Intergenic
1117439680 14:55747966-55747988 CTTCCCGAAACACAAAACCAGGG - Intergenic
1118424708 14:65647938-65647960 GCTCCCTAAGCAAAACCCCAAGG - Intronic
1118599365 14:67460870-67460892 GATCCCTTACCCCGAACCCATGG - Intronic
1121157105 14:91696243-91696265 GACCCCTAAATGCAAACCTAGGG - Intronic
1121415248 14:93774843-93774865 GAACCCTCAACTCAACCCCATGG + Intronic
1202840347 14_GL000009v2_random:115317-115339 GAGCTCAAAACACAAATCCATGG - Intergenic
1202909730 14_GL000194v1_random:105515-105537 GAGCTCAAAACACAAATCCATGG - Intergenic
1202883563 14_KI270722v1_random:83781-83803 GAGCTCAAAACACAAATCCATGG + Intergenic
1123928706 15:25145567-25145589 GATCCCTCAAGACAGCCCCAGGG - Intergenic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1127570400 15:60235944-60235966 GATCCATAAACACAGAGCCTGGG - Intergenic
1127886759 15:63208207-63208229 GAATCCTAAACTCTAACCCAGGG + Intronic
1128550794 15:68596794-68596816 GATCCAGATCCACAAACCCACGG + Intronic
1128584574 15:68836926-68836948 GATCTCTTAACAAAAACCTATGG + Intronic
1131438987 15:92444516-92444538 CATCCCCAAACAAAGACCCAGGG - Intronic
1133346721 16:5076017-5076039 GATCCCCAAATTAAAACCCAGGG + Intronic
1133909281 16:10050279-10050301 GATCCCCAAACCCCAAGCCACGG + Intronic
1135752907 16:25071031-25071053 GGGCCCTGAACACAAACCCAGGG - Intergenic
1137794650 16:51205378-51205400 GAACCCTAAAAACAAATCCAAGG - Intergenic
1139725559 16:68894690-68894712 AATCCCCAAACACATACCCCTGG - Intronic
1139763340 16:69205600-69205622 GATGCCAGAACACAAATCCAGGG - Intronic
1140819290 16:78648228-78648250 TATCCCTATACAAAGACCCAAGG + Intronic
1141271003 16:82541252-82541274 GATCCATAAACCCACCCCCAGGG - Intergenic
1142770801 17:2095348-2095370 GGAGCCTAAACACAAACCTAAGG - Intronic
1147299371 17:39512297-39512319 GATTCCTAACCACCCACCCAGGG + Intronic
1148843884 17:50517352-50517374 CATCCGTAAACTCAAACCCATGG + Exonic
1148882722 17:50743056-50743078 GAATCCTAAACACAATCCCCAGG - Intronic
1150777929 17:68096713-68096735 GAGACATAAACATAAACCCAAGG + Intergenic
1151304755 17:73256164-73256186 GATCCCCAAACAAACACCGAGGG + Intronic
1151494761 17:74452828-74452850 GAACACCAAACACAAACTCAGGG - Intergenic
1152661153 17:81542808-81542830 GATATCTGGACACAAACCCAGGG + Intronic
1156024404 18:32635243-32635265 TATCCCTAAAGACATAGCCATGG + Intergenic
1156497714 18:37536939-37536961 GATTCCTACACATAAAGCCAAGG + Intronic
1157359820 18:46966525-46966547 CATCTCAAAACACAAACACAAGG - Intronic
1157360419 18:47020125-47020147 CATCTCAAAACACAAACACAAGG - Intronic
1157361408 18:47026040-47026062 CATCTCAAAACACAAACACAAGG - Intronic
1157409906 18:47454848-47454870 GATCCCCAATCACCAGCCCATGG - Intergenic
1164798953 19:31060084-31060106 TATCTCTCAGCACAAACCCAAGG + Intergenic
1165394386 19:35556400-35556422 GTTCCCCAAACACAAAACAAGGG - Intronic
1202653165 1_KI270707v1_random:24816-24838 GAGCTCAAAACACAAATCCATGG - Intergenic
1202658984 1_KI270708v1_random:50929-50951 GAGCTCAAAACACAAATCCATGG + Intergenic
925126758 2:1462315-1462337 GGTCCCTGGACACAAACTCAGGG + Intronic
925654709 2:6133807-6133829 CATAACTAAATACAAACCCAGGG - Intergenic
927683187 2:25153694-25153716 GATGCCTAGACACAAACACACGG - Exonic
933041448 2:77472331-77472353 TATCTCTAAACAGAAACACATGG + Intronic
934676275 2:96252007-96252029 GATGCCTGAGCACAAAGCCAAGG - Exonic
939044672 2:137236330-137236352 GAAACCAAAACACCAACCCAGGG - Intronic
939597308 2:144141952-144141974 GATTCCTGATCACAGACCCAAGG - Exonic
943575239 2:189624404-189624426 TATCCCTAAAGACAAAGCCAGGG - Intergenic
943752601 2:191525449-191525471 GATACTTGAACCCAAACCCAGGG - Intergenic
943969500 2:194385619-194385641 GAGCTCAAAACACAAATCCATGG + Intergenic
944962576 2:204891856-204891878 GATGCATAAACACAGAGCCAGGG - Intronic
945018057 2:205540812-205540834 GCTGGCTGAACACAAACCCATGG - Intronic
946322378 2:218961371-218961393 GATGCAGACACACAAACCCAAGG - Exonic
1172883588 20:38217163-38217185 GATACCTAGACACAGCCCCATGG - Intronic
1175262452 20:57683233-57683255 GCTCCCTAAACTCAAGCCAAGGG + Intronic
1176598986 21:8774835-8774857 GAGCTCAAAACACAAATCCATGG + Intergenic
1176629077 21:9120222-9120244 GAGCTCAAAACACAAATCCATGG - Intergenic
1177010433 21:15725393-15725415 GATCCCTGAAGAACAACCCAGGG - Intergenic
1179881388 21:44294555-44294577 GCTCCCCCAACACCAACCCAAGG - Intronic
1180143248 21:45905802-45905824 CATCTCTAAACACAATCACACGG + Intronic
1180326448 22:11434445-11434467 GAGCTCAAAACACAAATCCATGG + Intergenic
1180378061 22:12113215-12113237 GAGCTCAAAACACAAATCCATGG + Intergenic
1180419446 22:12800066-12800088 GAGCTCAAAACACAAATCCATGG - Intergenic
1181070802 22:20338018-20338040 GATCCCTAATCACATCACCATGG - Intergenic
1182857397 22:33529903-33529925 GCTGCCAAAACACAAACACATGG - Intronic
1183492244 22:38122888-38122910 GATCCCCAAACCCAAGCCCATGG + Intronic
953137158 3:40190840-40190862 GATCCCTCACCCTAAACCCAAGG - Intronic
953463201 3:43097655-43097677 TATCTCTAAACACAATCACAGGG + Intronic
961338152 3:126197629-126197651 GAGCTCAAAACACAAATCCATGG + Intronic
963675915 3:148311440-148311462 GAGCCCACAACACAAATCCAAGG + Intergenic
964703656 3:159595540-159595562 GATCCCAAAACACAAGACAATGG + Intronic
965295031 3:166934160-166934182 TATATCTAAACACAAACACAAGG + Intergenic
965640768 3:170826425-170826447 CATCCCTAATCCCAAAGCCAAGG + Intronic
968074133 3:195807014-195807036 GGTCCCTAAACACATACACGGGG + Intronic
971568200 4:28172670-28172692 GCTCCCTAACCATAAACACATGG - Intergenic
973036995 4:45419651-45419673 TATCCCTAATAACAAAACCAAGG - Intergenic
973362338 4:49177207-49177229 GAGCTCAAAACACAAATCCATGG + Intergenic
973398761 4:49619654-49619676 GAGCTCAAAACACAAATCCATGG - Intergenic
973814352 4:54605049-54605071 GAGCTCAAAACACAAATCCACGG + Intergenic
974439955 4:61903056-61903078 GATAGCTAGACACAAACACATGG + Intronic
975719709 4:77237762-77237784 GATCCCTATGGACACACCCAAGG - Intronic
981127126 4:141119712-141119734 CATCCCTGAACAGAAGCCCAAGG + Intronic
1202759677 4_GL000008v2_random:98680-98702 GAGCTCAAAACACAAATCCATGG + Intergenic
994733563 5:103523711-103523733 GATTCCTAAACGCACACACATGG + Intergenic
995018703 5:107342882-107342904 GAACCCTGAACACTAACTCAGGG - Intergenic
995337449 5:111016512-111016534 GCTCCCTAAACACTATCCTAGGG + Intergenic
996789243 5:127274881-127274903 GATCCCTAAAGAAAAAGCAAGGG - Intergenic
999838970 5:155403562-155403584 GGCCAATAAACACAAACCCAGGG + Intergenic
1000339092 5:160263376-160263398 GATCCAAAAACACAAAACAAAGG - Intronic
1000423263 5:161061383-161061405 GAGCCCTAATCAATAACCCATGG - Intergenic
1000926648 5:167202494-167202516 AATACCTAAACACAAATGCAAGG - Intergenic
1002949649 6:1797010-1797032 GATCCCTAAACCCCAGGCCAGGG + Intronic
1003130024 6:3387421-3387443 GGTCACAAAAGACAAACCCAAGG + Intronic
1007396241 6:41579376-41579398 GATCCCCACATACAATCCCAGGG + Intronic
1007597612 6:43061131-43061153 GATCACTAAACTCAAAGCTAAGG - Intronic
1008009724 6:46453149-46453171 GATCCCGAAAGATGAACCCAGGG + Intronic
1008204852 6:48642324-48642346 GATCCTTAGACACAAAAACAGGG - Intergenic
1014163352 6:118195774-118195796 GAGCTCAAAACACAAATCCATGG + Intronic
1014495131 6:122112021-122112043 GATCCCAAACCACAAACACATGG + Intergenic
1016641514 6:146354557-146354579 GATCCCTAAGAAAAGACCCAGGG - Intronic
1017349060 6:153418539-153418561 GACCCCAAAACACAAATCCGTGG + Intergenic
1023348565 7:39296544-39296566 AATCCCTAAACACAGCCTCAAGG + Intronic
1027133029 7:75604925-75604947 GATCCATAGTCACAAACTCACGG - Intronic
1027665178 7:81035823-81035845 CATGCCTGAAAACAAACCCATGG - Intergenic
1029811260 7:103051429-103051451 GAGCTCAAAACACAAATCCATGG + Intronic
1033304171 7:140212309-140212331 GCTCCCTAAACATAGACACAGGG + Intergenic
1040020369 8:42735668-42735690 GGTCCATAAACACAAAGTCAAGG - Intronic
1041605181 8:59773684-59773706 GAGCTCAAAACACAAATCCATGG + Intergenic
1046900350 8:119516949-119516971 CATCCCTAATCCCAACCCCAAGG + Intergenic
1047240808 8:123086378-123086400 GCTCCCCAAACACAAAGACACGG + Intronic
1048776965 8:137957606-137957628 GATTACTAAATAGAAACCCAGGG - Intergenic
1049458240 8:142705848-142705870 GCTCCCCAAACTCAAGCCCAGGG - Intergenic
1050163877 9:2744662-2744684 GTTCCCAAGAGACAAACCCAAGG - Intronic
1050657670 9:7847088-7847110 GAGCTCAAAACACAAATCCATGG - Intronic
1203691466 Un_GL000214v1:46895-46917 GAGCTCAAAACACAAATCCATGG + Intergenic
1203751920 Un_GL000218v1:87904-87926 GAGCTCAAAACACAAATCCATGG - Intergenic
1203540454 Un_KI270743v1:83575-83597 GAGCTCAAAACACAAATCCATGG + Intergenic
1203644829 Un_KI270751v1:57296-57318 GAGCTCAAAACACAAATCCATGG - Intergenic
1189221681 X:39377610-39377632 GATTCCTAAAAAAGAACCCAGGG - Intergenic
1191671606 X:63753573-63753595 AATCCCCAAACTCAAATCCAGGG + Intronic
1193315413 X:80059197-80059219 GAACTCAAAACACAAACCCATGG + Intergenic
1194187640 X:90792897-90792919 GAACCCAAAACACAAATCCGTGG - Intergenic
1195028379 X:100901148-100901170 GATACATACACACAAACCAATGG - Intergenic
1197910794 X:131480807-131480829 GACATCTAAATACAAACCCAAGG + Intergenic
1198498114 X:137214254-137214276 GAGCTCAAAACACAAATCCATGG - Intergenic
1198968720 X:142255363-142255385 CATCTCTTAACACAAATCCATGG - Intergenic
1201165579 Y:11205524-11205546 GAGCTCAAAACACAAATCCATGG - Intergenic
1202064881 Y:20928440-20928462 TTTCCCTAAGCACAAACCAATGG + Intergenic