ID: 1103223376

View in Genome Browser
Species Human (GRCh38)
Location 12:119265736-119265758
Sequence CATTTTTAAGTGAGAACTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103223376_1103223383 15 Left 1103223376 12:119265736-119265758 CCACAAGTTCTCACTTAAAAATG No data
Right 1103223383 12:119265774-119265796 GTACACACAGACATAAAGGTGGG No data
1103223376_1103223382 14 Left 1103223376 12:119265736-119265758 CCACAAGTTCTCACTTAAAAATG No data
Right 1103223382 12:119265773-119265795 GGTACACACAGACATAAAGGTGG No data
1103223376_1103223380 -7 Left 1103223376 12:119265736-119265758 CCACAAGTTCTCACTTAAAAATG No data
Right 1103223380 12:119265752-119265774 AAAAATGGGAGCTACGCATTGGG No data
1103223376_1103223379 -8 Left 1103223376 12:119265736-119265758 CCACAAGTTCTCACTTAAAAATG No data
Right 1103223379 12:119265751-119265773 TAAAAATGGGAGCTACGCATTGG No data
1103223376_1103223381 11 Left 1103223376 12:119265736-119265758 CCACAAGTTCTCACTTAAAAATG No data
Right 1103223381 12:119265770-119265792 TTGGGTACACACAGACATAAAGG No data
1103223376_1103223384 30 Left 1103223376 12:119265736-119265758 CCACAAGTTCTCACTTAAAAATG No data
Right 1103223384 12:119265789-119265811 AAGGTGGGAACAATAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103223376 Original CRISPR CATTTTTAAGTGAGAACTTG TGG (reversed) Intergenic
No off target data available for this crispr