ID: 1103223381

View in Genome Browser
Species Human (GRCh38)
Location 12:119265770-119265792
Sequence TTGGGTACACACAGACATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103223376_1103223381 11 Left 1103223376 12:119265736-119265758 CCACAAGTTCTCACTTAAAAATG No data
Right 1103223381 12:119265770-119265792 TTGGGTACACACAGACATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103223381 Original CRISPR TTGGGTACACACAGACATAA AGG Intergenic
No off target data available for this crispr